Limits...
Distinct immunological activation profiles of dSLIM ® and ProMune ® depend on their different structural context

View Article: PubMed Central - PubMed

ABSTRACT

Introduction: DNA‐based TLR9 agonists are potent activators of the immune system. ProMune® and dSLIM® belong to different families of TLR9 agonists and both have been established as cancer immunotherapeutics in clinical proof‐of‐concept studies. Unfortunately, ProMune® failed in pivotal oncological trials. dSLIM®, the active ingredient of Lefitolimod (MGN1703), successfully finished a double‐blinded, placebo‐controlled phase II study in patients with advanced colorectal cancer, exhibiting improved progression‐free survival and durable disease control.

Methods: To explain the different systemic efficacies of dSLIM® and ProMune®, both TLR9 agonists and chimeric molecules thereof are analyzed side‐by‐side in a panel of in vitro assays for immune activation.

Results and conclusions: Indeed, dSLIM® exposure results in an IFN‐α dependent broad activation of immune cells whereas ProMune® strongly stimulates B cells. Moreover, all functional effects of dSLIM® strictly depend on the presence of CG‐motifs within its dumbbell‐shaped, covalently closed structural context. Conversely, several immunological effects of ProMune® like IL‐8 secretion are independent of CG‐motifs and could be ascribed to the phosphorothioate‐modifications of its DNA backbone, which may have caused the side effects of ProMune® in clinical trials. Finally, we showed that the implementation of ProMune® (ODN2006) base sequence into the characteristic dSLIM® dumbbell form resulted in dSLIM2006 with all beneficial effects for immunostimulation combined from both TLR9 classes without any CG‐independent effects.

No MeSH data available.


Structure and functions of dSLIM® and ProMune® on TLR9 positive cells. (a) Sequences and proposed structures of dSLIM® and ProMune®. CG‐motifs are depicted in bold. *Indicate a PTO bond instead of genuine phosphodiester bond between deoxynucleotides. (b–d) Isolated TLR9‐positive cells, pDC, and B cells, were treated with dSLIM® or ProMune® at final concentrations of 3 μM or medium alone for 48 h. A final concentration of 10 ng/mL IL‐3 was added to the pDC cultures. IFN‐α levels in the supernatants of pDC (b) were determined by a bead‐based multiplex immunoassay (n = 19, means are shown, **P < 0.01, repeated measures ANOVA, Bonferroni's multiple comparison test). pDC were stained with αCD80 antibody and analyzed by flow cytometry (c). Frequency of CD80‐expressing cells within the pDC population are shown (n = 20, means are shown, ***P < 0.001, repeated measures ANOVA, Bonferroni's multiple comparison test). B cells (d) were stained with αCD86 antibody and analyzed by flow cytometry. Frequency of CD86‐expressing cells within the B cell population are shown (n = 4, means are shown, **P < 0.01, ***P < 0.001, repeated measures ANOVA, Bonferroni's multiple comparison test).
© Copyright Policy - creativeCommonsBy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC5134728&req=5

iid3126-fig-0001: Structure and functions of dSLIM® and ProMune® on TLR9 positive cells. (a) Sequences and proposed structures of dSLIM® and ProMune®. CG‐motifs are depicted in bold. *Indicate a PTO bond instead of genuine phosphodiester bond between deoxynucleotides. (b–d) Isolated TLR9‐positive cells, pDC, and B cells, were treated with dSLIM® or ProMune® at final concentrations of 3 μM or medium alone for 48 h. A final concentration of 10 ng/mL IL‐3 was added to the pDC cultures. IFN‐α levels in the supernatants of pDC (b) were determined by a bead‐based multiplex immunoassay (n = 19, means are shown, **P < 0.01, repeated measures ANOVA, Bonferroni's multiple comparison test). pDC were stained with αCD80 antibody and analyzed by flow cytometry (c). Frequency of CD80‐expressing cells within the pDC population are shown (n = 20, means are shown, ***P < 0.001, repeated measures ANOVA, Bonferroni's multiple comparison test). B cells (d) were stained with αCD86 antibody and analyzed by flow cytometry. Frequency of CD86‐expressing cells within the B cell population are shown (n = 4, means are shown, **P < 0.01, ***P < 0.001, repeated measures ANOVA, Bonferroni's multiple comparison test).

Mentions: dSLIM® and ProMune® as depicted in Figure 1. dSLIM®: educt ODN for dSLIM®, CTAGGGGTTACCACCTTCATTGGAAAACGTTCTTCGGGGCGTTCTTAGGTGGTAACCC; educt for dSLIM2006‐PD, CTAGGGGTTACCACCTTCATCGTCGTTTTGTCGTTTTGTCGTTCTTAGGTGGTAACCC; educt for dSLIM2006‐PTO, CCTAGGGGTTACCACCTTCAT*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*TCTTAGGTGGTAACC; educt for dSLIM2006‐PD(‐CG), CTAGGGGTTACCACCTTCATGCTGCTTTTGTGCTTTTGTGCTTCTTAGGTGGTAACCC; educt for dSLIM2006‐PTO(‐CG), CCTAGGGGTTACCACCTTCAT*G*C*T*G*C*T*T*T*T*G*T*G*C*T*T*T*T*G*T*G*C*T*TCTTAGGTGGTAACC; LMLS variants: LMLS, TCATTGGAAAACGTTCTTCGGGGCGTTCTT; LMLS‐1tPTO, T*CATTGGAAAACGTTCTTCGGGGCGTTCT*T; LMLS‐2tPTO T*C*ATTGGAAAACGTTCTTCGGGGCGTTC*T*TT; LMLS‐PTO, T*C*A*T*T*G*G*A*A*A*A*C*G*T*T*C*T*T*C*G*G*G*G*C*G*T*T*C*T*T; LMLS‐PTO(‐CG), T*C*A*T*T*G*G*A*A*A*A*G*C*T*T*C*T*T*T*G*G*G*G*G*C*T*T*C*T*T; ProMune‐CG, T*G*C*T*G*C*T*T*T*T*G*T*G*C*T*T*T*T*G*T*G*C*T*T; ODN2216, G*G*GGGACGATCGTCG*G*G*G*G*G denotes PTO bond between deoxynucleotides. ODN were custom synthesized by Micro­synth (Balgach, Switzerland) or TIB Molbiol (Berlin, Germany). Construction of dSLIM® is described elsewhere 25, dSLIM® variants are constructed accordingly.


Distinct immunological activation profiles of dSLIM ® and ProMune ® depend on their different structural context
Structure and functions of dSLIM® and ProMune® on TLR9 positive cells. (a) Sequences and proposed structures of dSLIM® and ProMune®. CG‐motifs are depicted in bold. *Indicate a PTO bond instead of genuine phosphodiester bond between deoxynucleotides. (b–d) Isolated TLR9‐positive cells, pDC, and B cells, were treated with dSLIM® or ProMune® at final concentrations of 3 μM or medium alone for 48 h. A final concentration of 10 ng/mL IL‐3 was added to the pDC cultures. IFN‐α levels in the supernatants of pDC (b) were determined by a bead‐based multiplex immunoassay (n = 19, means are shown, **P < 0.01, repeated measures ANOVA, Bonferroni's multiple comparison test). pDC were stained with αCD80 antibody and analyzed by flow cytometry (c). Frequency of CD80‐expressing cells within the pDC population are shown (n = 20, means are shown, ***P < 0.001, repeated measures ANOVA, Bonferroni's multiple comparison test). B cells (d) were stained with αCD86 antibody and analyzed by flow cytometry. Frequency of CD86‐expressing cells within the B cell population are shown (n = 4, means are shown, **P < 0.01, ***P < 0.001, repeated measures ANOVA, Bonferroni's multiple comparison test).
© Copyright Policy - creativeCommonsBy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC5134728&req=5

iid3126-fig-0001: Structure and functions of dSLIM® and ProMune® on TLR9 positive cells. (a) Sequences and proposed structures of dSLIM® and ProMune®. CG‐motifs are depicted in bold. *Indicate a PTO bond instead of genuine phosphodiester bond between deoxynucleotides. (b–d) Isolated TLR9‐positive cells, pDC, and B cells, were treated with dSLIM® or ProMune® at final concentrations of 3 μM or medium alone for 48 h. A final concentration of 10 ng/mL IL‐3 was added to the pDC cultures. IFN‐α levels in the supernatants of pDC (b) were determined by a bead‐based multiplex immunoassay (n = 19, means are shown, **P < 0.01, repeated measures ANOVA, Bonferroni's multiple comparison test). pDC were stained with αCD80 antibody and analyzed by flow cytometry (c). Frequency of CD80‐expressing cells within the pDC population are shown (n = 20, means are shown, ***P < 0.001, repeated measures ANOVA, Bonferroni's multiple comparison test). B cells (d) were stained with αCD86 antibody and analyzed by flow cytometry. Frequency of CD86‐expressing cells within the B cell population are shown (n = 4, means are shown, **P < 0.01, ***P < 0.001, repeated measures ANOVA, Bonferroni's multiple comparison test).
Mentions: dSLIM® and ProMune® as depicted in Figure 1. dSLIM®: educt ODN for dSLIM®, CTAGGGGTTACCACCTTCATTGGAAAACGTTCTTCGGGGCGTTCTTAGGTGGTAACCC; educt for dSLIM2006‐PD, CTAGGGGTTACCACCTTCATCGTCGTTTTGTCGTTTTGTCGTTCTTAGGTGGTAACCC; educt for dSLIM2006‐PTO, CCTAGGGGTTACCACCTTCAT*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*TCTTAGGTGGTAACC; educt for dSLIM2006‐PD(‐CG), CTAGGGGTTACCACCTTCATGCTGCTTTTGTGCTTTTGTGCTTCTTAGGTGGTAACCC; educt for dSLIM2006‐PTO(‐CG), CCTAGGGGTTACCACCTTCAT*G*C*T*G*C*T*T*T*T*G*T*G*C*T*T*T*T*G*T*G*C*T*TCTTAGGTGGTAACC; LMLS variants: LMLS, TCATTGGAAAACGTTCTTCGGGGCGTTCTT; LMLS‐1tPTO, T*CATTGGAAAACGTTCTTCGGGGCGTTCT*T; LMLS‐2tPTO T*C*ATTGGAAAACGTTCTTCGGGGCGTTC*T*TT; LMLS‐PTO, T*C*A*T*T*G*G*A*A*A*A*C*G*T*T*C*T*T*C*G*G*G*G*C*G*T*T*C*T*T; LMLS‐PTO(‐CG), T*C*A*T*T*G*G*A*A*A*A*G*C*T*T*C*T*T*T*G*G*G*G*G*C*T*T*C*T*T; ProMune‐CG, T*G*C*T*G*C*T*T*T*T*G*T*G*C*T*T*T*T*G*T*G*C*T*T; ODN2216, G*G*GGGACGATCGTCG*G*G*G*G*G denotes PTO bond between deoxynucleotides. ODN were custom synthesized by Micro­synth (Balgach, Switzerland) or TIB Molbiol (Berlin, Germany). Construction of dSLIM® is described elsewhere 25, dSLIM® variants are constructed accordingly.

View Article: PubMed Central - PubMed

ABSTRACT

Introduction: DNA&#8208;based TLR9 agonists are potent activators of the immune system. ProMune&reg; and dSLIM&reg; belong to different families of TLR9 agonists and both have been established as cancer immunotherapeutics in clinical proof&#8208;of&#8208;concept studies. Unfortunately, ProMune&reg; failed in pivotal oncological trials. dSLIM&reg;, the active ingredient of Lefitolimod (MGN1703), successfully finished a double&#8208;blinded, placebo&#8208;controlled phase II study in patients with advanced colorectal cancer, exhibiting improved progression&#8208;free survival and durable disease control.

Methods: To explain the different systemic efficacies of dSLIM&reg; and ProMune&reg;, both TLR9 agonists and chimeric molecules thereof are analyzed side&#8208;by&#8208;side in a panel of in vitro assays for immune activation.

Results and conclusions: Indeed, dSLIM&reg; exposure results in an IFN&#8208;&alpha; dependent broad activation of immune cells whereas ProMune&reg; strongly stimulates B cells. Moreover, all functional effects of dSLIM&reg; strictly depend on the presence of CG&#8208;motifs within its dumbbell&#8208;shaped, covalently closed structural context. Conversely, several immunological effects of ProMune&reg; like IL&#8208;8 secretion are independent of CG&#8208;motifs and could be ascribed to the phosphorothioate&#8208;modifications of its DNA backbone, which may have caused the side effects of ProMune&reg; in clinical trials. Finally, we showed that the implementation of ProMune&reg; (ODN2006) base sequence into the characteristic dSLIM&reg; dumbbell form resulted in dSLIM2006 with all beneficial effects for immunostimulation combined from both TLR9 classes without any CG&#8208;independent effects.

No MeSH data available.