Limits...
In vivo model for microbial invasion of tooth root dentinal tubules.

Brittan JL, Sprague SV, Macdonald EL, Love RM, Jenkinson HF, West NX - J Appl Oral Sci (2016)

Bottom Line: A spectrum of Gram-positive and Gram-negative cell morphotypes were visualized, and molecular typing identified species of Granulicatella, Streptococcus, Klebsiella, Enterobacter, Acinetobacter, and Pseudomonas as dentinal tubule residents.A range of bacteria were able to initially invade dentinal tubules within exposed dentine.The model will be useful for testing the effectiveness of antiseptics, irrigants, and potential tubule occluding agents in preventing bacterial invasion of dentine.

View Article: PubMed Central - PubMed

Affiliation: Department of Oral and Dental Sciences, University of Bristol, Bristol, United Kingdom.

ABSTRACT
Objective Bacterial penetration of dentinal tubules via exposed dentine can lead to root caries and promote infections of the pulp and root canal system. The aim of this work was to develop a new experimental model for studying bacterial invasion of dentinal tubules within the human oral cavity. Material and Methods Sections of human root dentine were mounted into lower oral appliances that were worn by four human subjects for 15 d. Roots were then fixed, sectioned, stained and examined microscopically for evidence of bacterial invasion. Levels of invasion were expressed as Tubule Invasion Factor (TIF). DNA was extracted from root samples, subjected to polymerase chain reaction amplification of 16S rRNA genes, and invading bacteria were identified by comparison of sequences with GenBank database. Results All root dentine samples with patent tubules showed evidence of bacterial cell invasion (TIF value range from 5.7 to 9.0) to depths of 200 mm or more. A spectrum of Gram-positive and Gram-negative cell morphotypes were visualized, and molecular typing identified species of Granulicatella, Streptococcus, Klebsiella, Enterobacter, Acinetobacter, and Pseudomonas as dentinal tubule residents. Conclusion A novel in vivo model is described, which provides for human root dentine to be efficiently infected by oral microorganisms. A range of bacteria were able to initially invade dentinal tubules within exposed dentine. The model will be useful for testing the effectiveness of antiseptics, irrigants, and potential tubule occluding agents in preventing bacterial invasion of dentine.

No MeSH data available.


Related in: MedlinePlus

DGGE gel of DNA samples extracted from four (1-4) root dentine blocks (A) and agarose gel (B) showing PCR products derived from two selected DGGE gel bands from each sample (1-4). DNA bp markers (M) are indicated
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4836919&req=5

f02: DGGE gel of DNA samples extracted from four (1-4) root dentine blocks (A) and agarose gel (B) showing PCR products derived from two selected DGGE gel bands from each sample (1-4). DNA bp markers (M) are indicated

Mentions: The DNA extracts were used as templates in Polymerase Chain Reaction (PCR) amplification with universal 16S rRNA gene primers: DGGE F3(5’CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG) with the GC clamp for Denaturing Gradient Gel Electrophoresis (DGGE)25 and R2 (5’ATTACCGCGGCTGCTGG), to amplify a product of 160 bp. The presence of correct sized fragments was confirmed by agarose gel electrophoresis. Subsequently, aliquots (6 mL) of PCR products were subjected to DGGE (50-60% denaturant gradient) and the separated bands were ethidium bromide-stained and visualized under UV light (344 nm) (Figure 2A). Bands were excised from the gel lanes, transferred to tubes containing 0.3 mL TE buffer (5 mM Tris-HCl, 10 mM EDTA, pH 7.5) and the DNA was allowed to elute from the gel fragments for 16 h at 4°C.


In vivo model for microbial invasion of tooth root dentinal tubules.

Brittan JL, Sprague SV, Macdonald EL, Love RM, Jenkinson HF, West NX - J Appl Oral Sci (2016)

DGGE gel of DNA samples extracted from four (1-4) root dentine blocks (A) and agarose gel (B) showing PCR products derived from two selected DGGE gel bands from each sample (1-4). DNA bp markers (M) are indicated
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4836919&req=5

f02: DGGE gel of DNA samples extracted from four (1-4) root dentine blocks (A) and agarose gel (B) showing PCR products derived from two selected DGGE gel bands from each sample (1-4). DNA bp markers (M) are indicated
Mentions: The DNA extracts were used as templates in Polymerase Chain Reaction (PCR) amplification with universal 16S rRNA gene primers: DGGE F3(5’CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG) with the GC clamp for Denaturing Gradient Gel Electrophoresis (DGGE)25 and R2 (5’ATTACCGCGGCTGCTGG), to amplify a product of 160 bp. The presence of correct sized fragments was confirmed by agarose gel electrophoresis. Subsequently, aliquots (6 mL) of PCR products were subjected to DGGE (50-60% denaturant gradient) and the separated bands were ethidium bromide-stained and visualized under UV light (344 nm) (Figure 2A). Bands were excised from the gel lanes, transferred to tubes containing 0.3 mL TE buffer (5 mM Tris-HCl, 10 mM EDTA, pH 7.5) and the DNA was allowed to elute from the gel fragments for 16 h at 4°C.

Bottom Line: A spectrum of Gram-positive and Gram-negative cell morphotypes were visualized, and molecular typing identified species of Granulicatella, Streptococcus, Klebsiella, Enterobacter, Acinetobacter, and Pseudomonas as dentinal tubule residents.A range of bacteria were able to initially invade dentinal tubules within exposed dentine.The model will be useful for testing the effectiveness of antiseptics, irrigants, and potential tubule occluding agents in preventing bacterial invasion of dentine.

View Article: PubMed Central - PubMed

Affiliation: Department of Oral and Dental Sciences, University of Bristol, Bristol, United Kingdom.

ABSTRACT
Objective Bacterial penetration of dentinal tubules via exposed dentine can lead to root caries and promote infections of the pulp and root canal system. The aim of this work was to develop a new experimental model for studying bacterial invasion of dentinal tubules within the human oral cavity. Material and Methods Sections of human root dentine were mounted into lower oral appliances that were worn by four human subjects for 15 d. Roots were then fixed, sectioned, stained and examined microscopically for evidence of bacterial invasion. Levels of invasion were expressed as Tubule Invasion Factor (TIF). DNA was extracted from root samples, subjected to polymerase chain reaction amplification of 16S rRNA genes, and invading bacteria were identified by comparison of sequences with GenBank database. Results All root dentine samples with patent tubules showed evidence of bacterial cell invasion (TIF value range from 5.7 to 9.0) to depths of 200 mm or more. A spectrum of Gram-positive and Gram-negative cell morphotypes were visualized, and molecular typing identified species of Granulicatella, Streptococcus, Klebsiella, Enterobacter, Acinetobacter, and Pseudomonas as dentinal tubule residents. Conclusion A novel in vivo model is described, which provides for human root dentine to be efficiently infected by oral microorganisms. A range of bacteria were able to initially invade dentinal tubules within exposed dentine. The model will be useful for testing the effectiveness of antiseptics, irrigants, and potential tubule occluding agents in preventing bacterial invasion of dentine.

No MeSH data available.


Related in: MedlinePlus