Limits...
The Characterization of Novel Tissue Microbiota Using an Optimized 16S Metagenomic Sequencing Pipeline.

Lluch J, Servant F, Païssé S, Valle C, Valière S, Kuchly C, Vilchez G, Donnadieu C, Courtney M, Burcelin R, Amar J, Bouchez O, Lelouvier B - PLoS ONE (2015)

Bottom Line: However, the recently-discovered bacterial microbiota present within animal internal tissues has remained unexplored due to technical difficulties associated with these challenging samples.This was successfully achieved in various mouse tissues despite the high abundance of eukaryotic DNA and PCR inhibitors in these samples.The high throughput and excellent reproducibility of the method ensured exhaustive and precise coverage of the 16S rDNA bacterial variants present in mouse tissues.

View Article: PubMed Central - PubMed

Affiliation: Vaiomer SAS, Labège, France.

ABSTRACT

Background: Substantial progress in high-throughput metagenomic sequencing methodologies has enabled the characterisation of bacteria from various origins (for example gut and skin). However, the recently-discovered bacterial microbiota present within animal internal tissues has remained unexplored due to technical difficulties associated with these challenging samples.

Results: We have optimized a specific 16S rDNA-targeted metagenomics sequencing (16S metabarcoding) pipeline based on the Illumina MiSeq technology for the analysis of bacterial DNA in human and animal tissues. This was successfully achieved in various mouse tissues despite the high abundance of eukaryotic DNA and PCR inhibitors in these samples. We extensively tested this pipeline on mock communities, negative controls, positive controls and tissues and demonstrated the presence of novel tissue specific bacterial DNA profiles in a variety of organs (including brain, muscle, adipose tissue, liver and heart).

Conclusion: The high throughput and excellent reproducibility of the method ensured exhaustive and precise coverage of the 16S rDNA bacterial variants present in mouse tissues. This optimized 16S metagenomic sequencing pipeline will allow the scientific community to catalogue the bacterial DNA profiles of different tissues and will provide a database to analyse host/bacterial interactions in relation to homeostasis and disease.

No MeSH data available.


16S metagenomics on diverse tissue samples.(a) Heatmap of the relative abundance of each bacterial family from sequencing of different mouse tissue samples performed in triplicate (three different mice for each tissue). Each line corresponds to a bacterial family; each one of the three columns for a tissue corresponds to a different mouse. (b) Generalized UniFrac distance-based PCoA analysis of sequencing data from the samples shown in a compared with the negative control generated by sequencing molecular biology-grade water with the same pipeline (H2O). UniFrac weight parameter (Alpha) was set to 0.2 for this analysis. (c) Rarefaction curve of the sequencing of the samples shown in a and b. For each tissue, only the sample with the median number of OTU is displayed. (d) Stacked bar charts showing the relative abundance of bacterial phyla obtained by sequencing of the mouse samples shown in a, b and c. (e) The relative abundance as in d, but at the family taxonomic level. MAT: Mesenteric adipose tissue. OTU: Operational Taxonomic Unit.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4636327&req=5

pone.0142334.g004: 16S metagenomics on diverse tissue samples.(a) Heatmap of the relative abundance of each bacterial family from sequencing of different mouse tissue samples performed in triplicate (three different mice for each tissue). Each line corresponds to a bacterial family; each one of the three columns for a tissue corresponds to a different mouse. (b) Generalized UniFrac distance-based PCoA analysis of sequencing data from the samples shown in a compared with the negative control generated by sequencing molecular biology-grade water with the same pipeline (H2O). UniFrac weight parameter (Alpha) was set to 0.2 for this analysis. (c) Rarefaction curve of the sequencing of the samples shown in a and b. For each tissue, only the sample with the median number of OTU is displayed. (d) Stacked bar charts showing the relative abundance of bacterial phyla obtained by sequencing of the mouse samples shown in a, b and c. (e) The relative abundance as in d, but at the family taxonomic level. MAT: Mesenteric adipose tissue. OTU: Operational Taxonomic Unit.

Mentions: Except mentioned otherwise, all samples (Figs 1–4, S1 and S2 Figs) were analyzed in triplicate starting from the extracted DNA. The replicates presented were technical except in Fig 3B which displays both technical and biological replicates (3 mice with three technical replicates each) and Fig 4 which only presents biological replicates (three mice for each tissue). Negative controls to assess technical background were performed using Nuclease-free water (Ambion, LifeTechnologies) either in place of the tissue sample during the extraction step (lysis + trizol protocol), or in place of the extracted DNA during the library preparation. Each triplicate underwent all library preparation steps, sequencing and bioinformatics analysis, as described below. The V3-V4 hyper-variable regions of the 16S rDNA gene were amplified from the DNA extracts during the first PCR step using universal primer Vaiomer 1F (CTTTCCCTACACGACGCTCTTCCGATCT-TCCTACGGGAGGCAGCAGT, partial P5 adapter–primer) and universal primer Vaiomer 1R (GGAGTTCAGACGTGTGCTCTTCCGATCT-GGACTACCAGGGTATCTAATCCTGTT, partial P7 adapter–primer) which are fusion primers based on the qPCR primers designed by Nadkarni et al. [21]. Primers Vaiomer 1F and 1R include specificity for the 16S rDNA gene of 95% of the bacteria in the Ribosomal Database Project and part of the P5/P7 adapter targeted by the second PCR step (CTTTCCCTACACGAC and GGAGTTCAGACGTGT). Our primer design and 2 step PCR strategy allow shorter primers which are more suitable for the amplification of bacterial DNA extracted from tissue samples carrying large amounts of PCR inhibitors and eukaryotic DNA. This PCR was performed using 2 U of a DNA-free Taq DNA Polymerase and 1x Taq DNA polymerase buffer (MTP Taq DNA Polymerase, Sigma). The buffer was complemented with 10 nmol of dNTP mixture (Euromedex, Souffelweyersheim, France), 15 nmol of each primer (Sigma) and Nuclease-free water (Ambion, Life Technologies) in a final volume of 50 μl. The PCR reaction was carried out on a Veriti Thermal Cycler (Life Technologies) as follows: an initial denaturation step (94°C for 10 min), 35 cycles of amplification (94°C for 1 min, 68°C for 1 min and 72°C for 1 min) and a final elongation step at 72°C for 10 min. Amplicons were then purified using the magnetic beads Agencourt AMPure XP—PCR Purification (Beckman Coulter, Brea, CA, USA) following the 96 well format procedure modified as follow: beads/PCR reactional volume ratio of 0.8 x and final elution volume of 32 μl using Elution Buffer EB (Qiagen). The concentration of the purified amplicons was controlled using Nanodrop 8000 spectrophotometry (Thermo Scientific).


The Characterization of Novel Tissue Microbiota Using an Optimized 16S Metagenomic Sequencing Pipeline.

Lluch J, Servant F, Païssé S, Valle C, Valière S, Kuchly C, Vilchez G, Donnadieu C, Courtney M, Burcelin R, Amar J, Bouchez O, Lelouvier B - PLoS ONE (2015)

16S metagenomics on diverse tissue samples.(a) Heatmap of the relative abundance of each bacterial family from sequencing of different mouse tissue samples performed in triplicate (three different mice for each tissue). Each line corresponds to a bacterial family; each one of the three columns for a tissue corresponds to a different mouse. (b) Generalized UniFrac distance-based PCoA analysis of sequencing data from the samples shown in a compared with the negative control generated by sequencing molecular biology-grade water with the same pipeline (H2O). UniFrac weight parameter (Alpha) was set to 0.2 for this analysis. (c) Rarefaction curve of the sequencing of the samples shown in a and b. For each tissue, only the sample with the median number of OTU is displayed. (d) Stacked bar charts showing the relative abundance of bacterial phyla obtained by sequencing of the mouse samples shown in a, b and c. (e) The relative abundance as in d, but at the family taxonomic level. MAT: Mesenteric adipose tissue. OTU: Operational Taxonomic Unit.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4636327&req=5

pone.0142334.g004: 16S metagenomics on diverse tissue samples.(a) Heatmap of the relative abundance of each bacterial family from sequencing of different mouse tissue samples performed in triplicate (three different mice for each tissue). Each line corresponds to a bacterial family; each one of the three columns for a tissue corresponds to a different mouse. (b) Generalized UniFrac distance-based PCoA analysis of sequencing data from the samples shown in a compared with the negative control generated by sequencing molecular biology-grade water with the same pipeline (H2O). UniFrac weight parameter (Alpha) was set to 0.2 for this analysis. (c) Rarefaction curve of the sequencing of the samples shown in a and b. For each tissue, only the sample with the median number of OTU is displayed. (d) Stacked bar charts showing the relative abundance of bacterial phyla obtained by sequencing of the mouse samples shown in a, b and c. (e) The relative abundance as in d, but at the family taxonomic level. MAT: Mesenteric adipose tissue. OTU: Operational Taxonomic Unit.
Mentions: Except mentioned otherwise, all samples (Figs 1–4, S1 and S2 Figs) were analyzed in triplicate starting from the extracted DNA. The replicates presented were technical except in Fig 3B which displays both technical and biological replicates (3 mice with three technical replicates each) and Fig 4 which only presents biological replicates (three mice for each tissue). Negative controls to assess technical background were performed using Nuclease-free water (Ambion, LifeTechnologies) either in place of the tissue sample during the extraction step (lysis + trizol protocol), or in place of the extracted DNA during the library preparation. Each triplicate underwent all library preparation steps, sequencing and bioinformatics analysis, as described below. The V3-V4 hyper-variable regions of the 16S rDNA gene were amplified from the DNA extracts during the first PCR step using universal primer Vaiomer 1F (CTTTCCCTACACGACGCTCTTCCGATCT-TCCTACGGGAGGCAGCAGT, partial P5 adapter–primer) and universal primer Vaiomer 1R (GGAGTTCAGACGTGTGCTCTTCCGATCT-GGACTACCAGGGTATCTAATCCTGTT, partial P7 adapter–primer) which are fusion primers based on the qPCR primers designed by Nadkarni et al. [21]. Primers Vaiomer 1F and 1R include specificity for the 16S rDNA gene of 95% of the bacteria in the Ribosomal Database Project and part of the P5/P7 adapter targeted by the second PCR step (CTTTCCCTACACGAC and GGAGTTCAGACGTGT). Our primer design and 2 step PCR strategy allow shorter primers which are more suitable for the amplification of bacterial DNA extracted from tissue samples carrying large amounts of PCR inhibitors and eukaryotic DNA. This PCR was performed using 2 U of a DNA-free Taq DNA Polymerase and 1x Taq DNA polymerase buffer (MTP Taq DNA Polymerase, Sigma). The buffer was complemented with 10 nmol of dNTP mixture (Euromedex, Souffelweyersheim, France), 15 nmol of each primer (Sigma) and Nuclease-free water (Ambion, Life Technologies) in a final volume of 50 μl. The PCR reaction was carried out on a Veriti Thermal Cycler (Life Technologies) as follows: an initial denaturation step (94°C for 10 min), 35 cycles of amplification (94°C for 1 min, 68°C for 1 min and 72°C for 1 min) and a final elongation step at 72°C for 10 min. Amplicons were then purified using the magnetic beads Agencourt AMPure XP—PCR Purification (Beckman Coulter, Brea, CA, USA) following the 96 well format procedure modified as follow: beads/PCR reactional volume ratio of 0.8 x and final elution volume of 32 μl using Elution Buffer EB (Qiagen). The concentration of the purified amplicons was controlled using Nanodrop 8000 spectrophotometry (Thermo Scientific).

Bottom Line: However, the recently-discovered bacterial microbiota present within animal internal tissues has remained unexplored due to technical difficulties associated with these challenging samples.This was successfully achieved in various mouse tissues despite the high abundance of eukaryotic DNA and PCR inhibitors in these samples.The high throughput and excellent reproducibility of the method ensured exhaustive and precise coverage of the 16S rDNA bacterial variants present in mouse tissues.

View Article: PubMed Central - PubMed

Affiliation: Vaiomer SAS, Labège, France.

ABSTRACT

Background: Substantial progress in high-throughput metagenomic sequencing methodologies has enabled the characterisation of bacteria from various origins (for example gut and skin). However, the recently-discovered bacterial microbiota present within animal internal tissues has remained unexplored due to technical difficulties associated with these challenging samples.

Results: We have optimized a specific 16S rDNA-targeted metagenomics sequencing (16S metabarcoding) pipeline based on the Illumina MiSeq technology for the analysis of bacterial DNA in human and animal tissues. This was successfully achieved in various mouse tissues despite the high abundance of eukaryotic DNA and PCR inhibitors in these samples. We extensively tested this pipeline on mock communities, negative controls, positive controls and tissues and demonstrated the presence of novel tissue specific bacterial DNA profiles in a variety of organs (including brain, muscle, adipose tissue, liver and heart).

Conclusion: The high throughput and excellent reproducibility of the method ensured exhaustive and precise coverage of the 16S rDNA bacterial variants present in mouse tissues. This optimized 16S metagenomic sequencing pipeline will allow the scientific community to catalogue the bacterial DNA profiles of different tissues and will provide a database to analyse host/bacterial interactions in relation to homeostasis and disease.

No MeSH data available.