Limits...
Rice tungro spherical virus resistance into photoperiod-insensitive japonica rice by marker-assisted selection.

Shim J, Torollo G, Angeles-Shim RB, Cabunagan RC, Choi IR, Yeo US, Ha WG - Breed. Sci. (2015)

Bottom Line: Japonica1, a rice variety bred for tropical conditions, is photoperiod-insensitive, has a high yield potential, but is susceptible to RTD and has poor grain quality.To transfer RTD resistance into Japonica1, we made two backcrosses (BC) and 8 three-way crosses (3-WC) among Japonica1 and RTSV-resistant cultivars.Among 8,876 BC1F2 and 3-WCF2 plants, 342 were selected for photoperiod-insensitivity and good grain quality.

View Article: PubMed Central - PubMed

Affiliation: Plant Breeding, Genetics, and Biotechnology Division, International Rice Research Institute , DAPO Box 7777, Metro Manila , Philippines.

ABSTRACT
Rice tungro disease (RTD) is one of the destructive and prevalent diseases in the tropical region. RTD is caused by Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus. Cultivation of japonica rice (Oryza sativa L. ssp japonica) in tropical Asia has often been restricted because most japonica cultivars are sensitive to short photoperiod, which is characteristic of tropical conditions. Japonica1, a rice variety bred for tropical conditions, is photoperiod-insensitive, has a high yield potential, but is susceptible to RTD and has poor grain quality. To transfer RTD resistance into Japonica1, we made two backcrosses (BC) and 8 three-way crosses (3-WC) among Japonica1 and RTSV-resistant cultivars. Among 8,876 BC1F2 and 3-WCF2 plants, 342 were selected for photoperiod-insensitivity and good grain quality. Photoperiod-insensitive progenies were evaluated for RTSV resistance by a bioassay and marker-assisted selection (MAS), and 22 BC1F7 and 3-WCF7 lines were selected based on the results of an observational yield trial. The results demonstrated that conventional selection for photoperiod-insensitivity and MAS for RTSV resistance can greatly facilitate the development of japonica rice that is suitable for cultivation in tropical Asia.

No MeSH data available.


Related in: MedlinePlus

Breeding scheme for the development of Rice tungro spherical virus (RTSV)-resistant photoperiod-insensitive rice via selection for RTSV resistance and grain quality. RTSV-resistant varieties, Dongjin, Hwaseong, and Sangju were crossed with Japonica1 to produce F1. MS11 and Jinmi were used as the donor for photoperiod insensitivity. DS) dry season, WS) wet season, OYT) observatory yield trial, PYT) preliminary yield trial, RYT) replication yield trial.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4542936&req=5

f1-65_345: Breeding scheme for the development of Rice tungro spherical virus (RTSV)-resistant photoperiod-insensitive rice via selection for RTSV resistance and grain quality. RTSV-resistant varieties, Dongjin, Hwaseong, and Sangju were crossed with Japonica1 to produce F1. MS11 and Jinmi were used as the donor for photoperiod insensitivity. DS) dry season, WS) wet season, OYT) observatory yield trial, PYT) preliminary yield trial, RYT) replication yield trial.

Mentions: MAS for RTSV resistance was carried out for F1, F3, F4, and F5 generations (Fig. 1). The F2 generations were excluded from MAS for RTSV resistance because of the selection of the F2 generations for photoperiod insensitivity. Genomic DNA samples were prepared from the young leaves of plants using the modified TPS method (Miura et al. 2009). The tips of rice leaves (5 cm) were excised and ground in TPS buffer (100 mM Tris-HCl [pH 8.0], 1 M KCl, 10 mM EDTA) using a GenoGrinder (OPS Diagnostics). After centrifugation, the supernatant was recovered and an equal volume of isopropyl alcohol was added. The isopropyl alcohol-insoluble material was recovered by centrifugation, and the pellet was rinsed with 75% ethanol. The pellet was then dried and dissolved in TE (10 mM Tris-HCl [pH 8.0], 1 mM EDTA, RNase A [10 mg/ml]). The DNA samples were then used for genotyping using the simple sequence repeat marker, rice microsatellite 336 (RM336, McCouch et al. 2002, forward primer: CTTACAGAGAAACGGCATCG, reverse: GCTGGTTTGTTTCAGGTTCG, 21.87 Mb of chromosome 7, according to IRGSP 1.0 of the rice annotation project database at http://rapdb.dna.affrc.go.jp/) that is tightly linked to the RTSV resistance gene (Lee et al. 2010). The PCR profile was as follows: pre-denaturation for 5 min at 95°C, 35 cycles of denaturation for 1 min at 95°C—annealing for 30 sec at 55°C—extension for 30 sec at 72°C, and final extension for 7 min at 72°C. The PCR products were resolved on TAE (Tris-Acetate-EDTA) agarose gel (3%) for 1 h at 250 volts.


Rice tungro spherical virus resistance into photoperiod-insensitive japonica rice by marker-assisted selection.

Shim J, Torollo G, Angeles-Shim RB, Cabunagan RC, Choi IR, Yeo US, Ha WG - Breed. Sci. (2015)

Breeding scheme for the development of Rice tungro spherical virus (RTSV)-resistant photoperiod-insensitive rice via selection for RTSV resistance and grain quality. RTSV-resistant varieties, Dongjin, Hwaseong, and Sangju were crossed with Japonica1 to produce F1. MS11 and Jinmi were used as the donor for photoperiod insensitivity. DS) dry season, WS) wet season, OYT) observatory yield trial, PYT) preliminary yield trial, RYT) replication yield trial.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4542936&req=5

f1-65_345: Breeding scheme for the development of Rice tungro spherical virus (RTSV)-resistant photoperiod-insensitive rice via selection for RTSV resistance and grain quality. RTSV-resistant varieties, Dongjin, Hwaseong, and Sangju were crossed with Japonica1 to produce F1. MS11 and Jinmi were used as the donor for photoperiod insensitivity. DS) dry season, WS) wet season, OYT) observatory yield trial, PYT) preliminary yield trial, RYT) replication yield trial.
Mentions: MAS for RTSV resistance was carried out for F1, F3, F4, and F5 generations (Fig. 1). The F2 generations were excluded from MAS for RTSV resistance because of the selection of the F2 generations for photoperiod insensitivity. Genomic DNA samples were prepared from the young leaves of plants using the modified TPS method (Miura et al. 2009). The tips of rice leaves (5 cm) were excised and ground in TPS buffer (100 mM Tris-HCl [pH 8.0], 1 M KCl, 10 mM EDTA) using a GenoGrinder (OPS Diagnostics). After centrifugation, the supernatant was recovered and an equal volume of isopropyl alcohol was added. The isopropyl alcohol-insoluble material was recovered by centrifugation, and the pellet was rinsed with 75% ethanol. The pellet was then dried and dissolved in TE (10 mM Tris-HCl [pH 8.0], 1 mM EDTA, RNase A [10 mg/ml]). The DNA samples were then used for genotyping using the simple sequence repeat marker, rice microsatellite 336 (RM336, McCouch et al. 2002, forward primer: CTTACAGAGAAACGGCATCG, reverse: GCTGGTTTGTTTCAGGTTCG, 21.87 Mb of chromosome 7, according to IRGSP 1.0 of the rice annotation project database at http://rapdb.dna.affrc.go.jp/) that is tightly linked to the RTSV resistance gene (Lee et al. 2010). The PCR profile was as follows: pre-denaturation for 5 min at 95°C, 35 cycles of denaturation for 1 min at 95°C—annealing for 30 sec at 55°C—extension for 30 sec at 72°C, and final extension for 7 min at 72°C. The PCR products were resolved on TAE (Tris-Acetate-EDTA) agarose gel (3%) for 1 h at 250 volts.

Bottom Line: Japonica1, a rice variety bred for tropical conditions, is photoperiod-insensitive, has a high yield potential, but is susceptible to RTD and has poor grain quality.To transfer RTD resistance into Japonica1, we made two backcrosses (BC) and 8 three-way crosses (3-WC) among Japonica1 and RTSV-resistant cultivars.Among 8,876 BC1F2 and 3-WCF2 plants, 342 were selected for photoperiod-insensitivity and good grain quality.

View Article: PubMed Central - PubMed

Affiliation: Plant Breeding, Genetics, and Biotechnology Division, International Rice Research Institute , DAPO Box 7777, Metro Manila , Philippines.

ABSTRACT
Rice tungro disease (RTD) is one of the destructive and prevalent diseases in the tropical region. RTD is caused by Rice tungro spherical virus (RTSV) and Rice tungro bacilliform virus. Cultivation of japonica rice (Oryza sativa L. ssp japonica) in tropical Asia has often been restricted because most japonica cultivars are sensitive to short photoperiod, which is characteristic of tropical conditions. Japonica1, a rice variety bred for tropical conditions, is photoperiod-insensitive, has a high yield potential, but is susceptible to RTD and has poor grain quality. To transfer RTD resistance into Japonica1, we made two backcrosses (BC) and 8 three-way crosses (3-WC) among Japonica1 and RTSV-resistant cultivars. Among 8,876 BC1F2 and 3-WCF2 plants, 342 were selected for photoperiod-insensitivity and good grain quality. Photoperiod-insensitive progenies were evaluated for RTSV resistance by a bioassay and marker-assisted selection (MAS), and 22 BC1F7 and 3-WCF7 lines were selected based on the results of an observational yield trial. The results demonstrated that conventional selection for photoperiod-insensitivity and MAS for RTSV resistance can greatly facilitate the development of japonica rice that is suitable for cultivation in tropical Asia.

No MeSH data available.


Related in: MedlinePlus