Limits...
Analysis of the Bacillus cereus SpoIIS antitoxin-toxin system reveals its three-component nature.

Melničáková J, Bečárová Z, Makroczyová J, Barák I - Front Microbiol (2015)

Bottom Line: In this work we describe the Bacillus cereus SpoIIS system which is a three-component system, harboring an additional gene spoIISC.Our results indicate that SpoIISC seems to be present not only in B. cereus but also in other Bacilli containing a SpoIIS toxin-antitoxin system.In addition, we show that B. cereus SpoIISA can form higher oligomers and we discuss the possible role of this multimerization for the protein's toxic function.

View Article: PubMed Central - PubMed

Affiliation: Institute of Molecular Biology, Slovak Academy of Sciences Bratislava, Slovakia.

ABSTRACT
Programmed cell death in bacteria is generally associated with two-component toxin-antitoxin systems. The SpoIIS toxin-antitoxin system, consisting of a membrane-bound SpoIISA toxin and a small, cytosolic antitoxin SpoIISB, was originally identified in Bacillus subtilis. In this work we describe the Bacillus cereus SpoIIS system which is a three-component system, harboring an additional gene spoIISC. Its protein product serves as an antitoxin, and similarly as SpoIISB, is able to bind SpoIISA and abolish its toxic effect. Our results indicate that SpoIISC seems to be present not only in B. cereus but also in other Bacilli containing a SpoIIS toxin-antitoxin system. In addition, we show that B. cereus SpoIISA can form higher oligomers and we discuss the possible role of this multimerization for the protein's toxic function.

No MeSH data available.


Related in: MedlinePlus

Comparison of the spoIIS loci of Bacillus cereus and Bacillus subtilis. (A) Genomic organization of the spoIIS locus in B. cereus and B. subtilis. (B) Alignment of the SpoIIS proteins of B. cereus (Bc) and B. subtilis (Bs). Amino acids printed in normal weight on a gray background indicate similar amino acids, while bold weight on a gray background indicates identical amino acids.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4526809&req=5

Figure 1: Comparison of the spoIIS loci of Bacillus cereus and Bacillus subtilis. (A) Genomic organization of the spoIIS locus in B. cereus and B. subtilis. (B) Alignment of the SpoIIS proteins of B. cereus (Bc) and B. subtilis (Bs). Amino acids printed in normal weight on a gray background indicate similar amino acids, while bold weight on a gray background indicates identical amino acids.

Mentions: We previously found that a two-component SpoIIS system also exists in B. cereus (Florek et al., 2008). The position of its locus on the chromosome is completely different from that of the spoIIS operon in B. subtilis. While the B. subtilis spoIIS operon is 115° away from the origin of replication, the B. cereus spoIIS locus is 158° away. The B. cereus spoIIS operon consists of spoIISA (BC_2436), which encodes a 245-residue SpoIISA-like protein, and BC_2437, which encodes a hypothetical protein with 58 residues. As shown in Florek et al. (2008), BC_2437 is found 316 bp downstream of the spoIISA-like gene and was named spoIISB since its SpoIISB-like product was able to neutralize the toxicity of the SpoIISA-like protein in E. coli. Prompted by the identification of a putative third transcript in the B. subtilis spoIIS operon (Nicolas et al., 2012), we revisited the bioinformatics analysis of the B. cereus spoIIS operon and found that the B. cereus spoIIS operon also likely contains three genes: the BC_2436 ORF encoding a 245-residue SpoIISA-like protein; a 138-bp ORF 103 bp downstream of this gene, which encodes a 45-residue, putative SpoIISB; and a further 72 bp downstream of that, the BC_2437 ORF, which encodes the 58-residue protein we had previously called SpoIISB, but which we now call SpoIISC (Figure 1; Florek et al., 2008). As in the B. subtilis analysis, BPROM identified putative promoters in this operon. B. cereus spoIISA appears to be driven by the putative promoter PA, the putative PB promoter for controlling spoIISB gene expression is found within the spoIISA gene, and the putative PC promoter that likely regulates the expression of spoIISC is located downstream of the spoIISB gene. ARNold tool predicts that a Rho-independent bacterial transcription terminator, with the sequence 5′-AA AGAACAAAAGAAAATGCATAGAGCATTTTCTTTTGTTTTTTT A-3′ (letters in bold indicates bases contributing to the loop structure, underlined letters are bases forming the stem of terminator hairpin). This sequence overlaps with the end of B. cereus spoIISC gene (Figure 1A).


Analysis of the Bacillus cereus SpoIIS antitoxin-toxin system reveals its three-component nature.

Melničáková J, Bečárová Z, Makroczyová J, Barák I - Front Microbiol (2015)

Comparison of the spoIIS loci of Bacillus cereus and Bacillus subtilis. (A) Genomic organization of the spoIIS locus in B. cereus and B. subtilis. (B) Alignment of the SpoIIS proteins of B. cereus (Bc) and B. subtilis (Bs). Amino acids printed in normal weight on a gray background indicate similar amino acids, while bold weight on a gray background indicates identical amino acids.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4526809&req=5

Figure 1: Comparison of the spoIIS loci of Bacillus cereus and Bacillus subtilis. (A) Genomic organization of the spoIIS locus in B. cereus and B. subtilis. (B) Alignment of the SpoIIS proteins of B. cereus (Bc) and B. subtilis (Bs). Amino acids printed in normal weight on a gray background indicate similar amino acids, while bold weight on a gray background indicates identical amino acids.
Mentions: We previously found that a two-component SpoIIS system also exists in B. cereus (Florek et al., 2008). The position of its locus on the chromosome is completely different from that of the spoIIS operon in B. subtilis. While the B. subtilis spoIIS operon is 115° away from the origin of replication, the B. cereus spoIIS locus is 158° away. The B. cereus spoIIS operon consists of spoIISA (BC_2436), which encodes a 245-residue SpoIISA-like protein, and BC_2437, which encodes a hypothetical protein with 58 residues. As shown in Florek et al. (2008), BC_2437 is found 316 bp downstream of the spoIISA-like gene and was named spoIISB since its SpoIISB-like product was able to neutralize the toxicity of the SpoIISA-like protein in E. coli. Prompted by the identification of a putative third transcript in the B. subtilis spoIIS operon (Nicolas et al., 2012), we revisited the bioinformatics analysis of the B. cereus spoIIS operon and found that the B. cereus spoIIS operon also likely contains three genes: the BC_2436 ORF encoding a 245-residue SpoIISA-like protein; a 138-bp ORF 103 bp downstream of this gene, which encodes a 45-residue, putative SpoIISB; and a further 72 bp downstream of that, the BC_2437 ORF, which encodes the 58-residue protein we had previously called SpoIISB, but which we now call SpoIISC (Figure 1; Florek et al., 2008). As in the B. subtilis analysis, BPROM identified putative promoters in this operon. B. cereus spoIISA appears to be driven by the putative promoter PA, the putative PB promoter for controlling spoIISB gene expression is found within the spoIISA gene, and the putative PC promoter that likely regulates the expression of spoIISC is located downstream of the spoIISB gene. ARNold tool predicts that a Rho-independent bacterial transcription terminator, with the sequence 5′-AA AGAACAAAAGAAAATGCATAGAGCATTTTCTTTTGTTTTTTT A-3′ (letters in bold indicates bases contributing to the loop structure, underlined letters are bases forming the stem of terminator hairpin). This sequence overlaps with the end of B. cereus spoIISC gene (Figure 1A).

Bottom Line: In this work we describe the Bacillus cereus SpoIIS system which is a three-component system, harboring an additional gene spoIISC.Our results indicate that SpoIISC seems to be present not only in B. cereus but also in other Bacilli containing a SpoIIS toxin-antitoxin system.In addition, we show that B. cereus SpoIISA can form higher oligomers and we discuss the possible role of this multimerization for the protein's toxic function.

View Article: PubMed Central - PubMed

Affiliation: Institute of Molecular Biology, Slovak Academy of Sciences Bratislava, Slovakia.

ABSTRACT
Programmed cell death in bacteria is generally associated with two-component toxin-antitoxin systems. The SpoIIS toxin-antitoxin system, consisting of a membrane-bound SpoIISA toxin and a small, cytosolic antitoxin SpoIISB, was originally identified in Bacillus subtilis. In this work we describe the Bacillus cereus SpoIIS system which is a three-component system, harboring an additional gene spoIISC. Its protein product serves as an antitoxin, and similarly as SpoIISB, is able to bind SpoIISA and abolish its toxic effect. Our results indicate that SpoIISC seems to be present not only in B. cereus but also in other Bacilli containing a SpoIIS toxin-antitoxin system. In addition, we show that B. cereus SpoIISA can form higher oligomers and we discuss the possible role of this multimerization for the protein's toxic function.

No MeSH data available.


Related in: MedlinePlus