Limits...
Development of a heptaplex PCR assay for identification of Staphylococcus aureus and CoNS with simultaneous detection of virulence and antibiotic resistance genes.

Okolie CE, Wooldridge KG, Turner DP, Cockayne A, James R - BMC Microbiol. (2015)

Bottom Line: Following successful validation using 255 reference bacterial strains, applicability to analyse clinical samples was evaluated by direct amplification in spiked blood cultures (n = 89) which returned 100 % specificity, negative and positive predictive values.In addition to the SA-CoNS differential diagnostic essence of the new assay, inclusion of vanA primers will allow microbiology laboratories to stay ahead of the emerging MRSA-VRSA evolution.To the best of our knowledge, the new heptaplex PCR assay is the most multiplexed among similar PCR-based assays for simultaneous detection of STAAR.

View Article: PubMed Central - PubMed

Affiliation: Centre for Healthcare Associated Infections, Centre for Biomolecular Sciences Building, The University of Nottingham, University Park, Nottingham, NG7 2RD, UK. okolie.charles@lmu.edu.ng.

ABSTRACT

Background: Staphylococcal toxicity and antibiotic resistance (STAAR) have been menacing public health. Although vancomycin-resistant Staphylococcus aureus (VRSA) is currently not as widespread as methicillin-resistant S. aureus (MRSA), genome evolution of MRSA into VRSA, including strains engineered within the same patient under anti-staphylococcal therapy, may build up to future public health concern. To further complicate diagnosis, infection control and anti-microbial chemotherapy, non-sterile sites such as the nares and the skin could contain both S. aureus and coagulase-negative staphylococci (CoNS), either of which could harbour mecA the gene driving staphylococcal methicillin-resistance and required for MRSA-VRSA evolution.

Results: A new heptaplex PCR assay has been developed which simultaneously detects seven markers for: i) eubacteria (16S rRNA), ii) Staphylococcus genus (tuf), iii) Staphylococcus aureus (spa), iv) CoNS (cns), v) Panton-Valentine leukocidin (pvl), vi) methicillin resistance (mecA), and vii) vancomycin resistance (vanA). Following successful validation using 255 reference bacterial strains, applicability to analyse clinical samples was evaluated by direct amplification in spiked blood cultures (n = 89) which returned 100 % specificity, negative and positive predictive values. The new assay has LoD of 1.0x10(3) CFU/mL for the 16S rRNA marker and 1.0x10(4) CFU/mL for six other markers and completes cycling in less than one hour.

Conclusion: The speed, sensitivity (100 %), NPV (100 %) and PPV (100 %) suggest the new heptaplex PCR assay could be easily integrated into a routine diagnostic microbiology workflow. Detection of the cns marker allows for unique identification of CoNS in mono-microbial and in poly-microbial samples containing mixtures of CoNS and S. aureus without recourse to the conventional elimination approach which is ambiguous. In addition to the SA-CoNS differential diagnostic essence of the new assay, inclusion of vanA primers will allow microbiology laboratories to stay ahead of the emerging MRSA-VRSA evolution. To the best of our knowledge, the new heptaplex PCR assay is the most multiplexed among similar PCR-based assays for simultaneous detection of STAAR.

No MeSH data available.


Related in: MedlinePlus

Development of the new heptaplex PCR showing the amplification of single and multiple DNA markers. Lane 1: 100 bp DNA Marker (New England Biolabs, NEB, UK) with upper band [200 bp] and lower band [100 bp], Lane 2: PCR negative control [Candida albicans], Lane 3: coagulase-negative staphylococcus marker [cns, 204 bp], Lane 4: bacterial 16S rRNA marker [16S, 174 bp], Lane 5: mecA marker [mecA, 155 bp], Lane 6: staphylococcus genus translation elongation factor marker [tuf, 143 bp], Lane 7: Panton-Valentine leukocidin marker [pvl, 118 bp], Lane 8: Vancomycin resistance marker [vanA, 111 bp], Lane 9: staphylococcal protein A marker [spa, 101 bp], Lane 10: Heptaplex PCR showing all seven markers (cns, 16S, mecA, tuf, pvl, vanA and spa) from top to bottom respectively
© Copyright Policy - open-access
Related In: Results  -  Collection

License 1 - License 2
getmorefigures.php?uid=PMC4525735&req=5

Fig1: Development of the new heptaplex PCR showing the amplification of single and multiple DNA markers. Lane 1: 100 bp DNA Marker (New England Biolabs, NEB, UK) with upper band [200 bp] and lower band [100 bp], Lane 2: PCR negative control [Candida albicans], Lane 3: coagulase-negative staphylococcus marker [cns, 204 bp], Lane 4: bacterial 16S rRNA marker [16S, 174 bp], Lane 5: mecA marker [mecA, 155 bp], Lane 6: staphylococcus genus translation elongation factor marker [tuf, 143 bp], Lane 7: Panton-Valentine leukocidin marker [pvl, 118 bp], Lane 8: Vancomycin resistance marker [vanA, 111 bp], Lane 9: staphylococcal protein A marker [spa, 101 bp], Lane 10: Heptaplex PCR showing all seven markers (cns, 16S, mecA, tuf, pvl, vanA and spa) from top to bottom respectively

Mentions: Bioinformatic analysis initially identified AAGACTGCACGTTCAGGCTC, a 20-letter oligonucleotide sequence as the vanA forward primer. Though the former vanA forward primer generated a vanA positive amplicon with very high specificity in a 235 bp monoplex PCR [29], it interfered with other reactions. Replacement of the interfering primer with the current vanA forward primer listed in Table 1 generated a 111 bp amplicon without interference thus allowing the simultaneous amplification of all the seven markers targeted by the new heptaplex PCR (Fig. 1).Fig. 1


Development of a heptaplex PCR assay for identification of Staphylococcus aureus and CoNS with simultaneous detection of virulence and antibiotic resistance genes.

Okolie CE, Wooldridge KG, Turner DP, Cockayne A, James R - BMC Microbiol. (2015)

Development of the new heptaplex PCR showing the amplification of single and multiple DNA markers. Lane 1: 100 bp DNA Marker (New England Biolabs, NEB, UK) with upper band [200 bp] and lower band [100 bp], Lane 2: PCR negative control [Candida albicans], Lane 3: coagulase-negative staphylococcus marker [cns, 204 bp], Lane 4: bacterial 16S rRNA marker [16S, 174 bp], Lane 5: mecA marker [mecA, 155 bp], Lane 6: staphylococcus genus translation elongation factor marker [tuf, 143 bp], Lane 7: Panton-Valentine leukocidin marker [pvl, 118 bp], Lane 8: Vancomycin resistance marker [vanA, 111 bp], Lane 9: staphylococcal protein A marker [spa, 101 bp], Lane 10: Heptaplex PCR showing all seven markers (cns, 16S, mecA, tuf, pvl, vanA and spa) from top to bottom respectively
© Copyright Policy - open-access
Related In: Results  -  Collection

License 1 - License 2
Show All Figures
getmorefigures.php?uid=PMC4525735&req=5

Fig1: Development of the new heptaplex PCR showing the amplification of single and multiple DNA markers. Lane 1: 100 bp DNA Marker (New England Biolabs, NEB, UK) with upper band [200 bp] and lower band [100 bp], Lane 2: PCR negative control [Candida albicans], Lane 3: coagulase-negative staphylococcus marker [cns, 204 bp], Lane 4: bacterial 16S rRNA marker [16S, 174 bp], Lane 5: mecA marker [mecA, 155 bp], Lane 6: staphylococcus genus translation elongation factor marker [tuf, 143 bp], Lane 7: Panton-Valentine leukocidin marker [pvl, 118 bp], Lane 8: Vancomycin resistance marker [vanA, 111 bp], Lane 9: staphylococcal protein A marker [spa, 101 bp], Lane 10: Heptaplex PCR showing all seven markers (cns, 16S, mecA, tuf, pvl, vanA and spa) from top to bottom respectively
Mentions: Bioinformatic analysis initially identified AAGACTGCACGTTCAGGCTC, a 20-letter oligonucleotide sequence as the vanA forward primer. Though the former vanA forward primer generated a vanA positive amplicon with very high specificity in a 235 bp monoplex PCR [29], it interfered with other reactions. Replacement of the interfering primer with the current vanA forward primer listed in Table 1 generated a 111 bp amplicon without interference thus allowing the simultaneous amplification of all the seven markers targeted by the new heptaplex PCR (Fig. 1).Fig. 1

Bottom Line: Following successful validation using 255 reference bacterial strains, applicability to analyse clinical samples was evaluated by direct amplification in spiked blood cultures (n = 89) which returned 100 % specificity, negative and positive predictive values.In addition to the SA-CoNS differential diagnostic essence of the new assay, inclusion of vanA primers will allow microbiology laboratories to stay ahead of the emerging MRSA-VRSA evolution.To the best of our knowledge, the new heptaplex PCR assay is the most multiplexed among similar PCR-based assays for simultaneous detection of STAAR.

View Article: PubMed Central - PubMed

Affiliation: Centre for Healthcare Associated Infections, Centre for Biomolecular Sciences Building, The University of Nottingham, University Park, Nottingham, NG7 2RD, UK. okolie.charles@lmu.edu.ng.

ABSTRACT

Background: Staphylococcal toxicity and antibiotic resistance (STAAR) have been menacing public health. Although vancomycin-resistant Staphylococcus aureus (VRSA) is currently not as widespread as methicillin-resistant S. aureus (MRSA), genome evolution of MRSA into VRSA, including strains engineered within the same patient under anti-staphylococcal therapy, may build up to future public health concern. To further complicate diagnosis, infection control and anti-microbial chemotherapy, non-sterile sites such as the nares and the skin could contain both S. aureus and coagulase-negative staphylococci (CoNS), either of which could harbour mecA the gene driving staphylococcal methicillin-resistance and required for MRSA-VRSA evolution.

Results: A new heptaplex PCR assay has been developed which simultaneously detects seven markers for: i) eubacteria (16S rRNA), ii) Staphylococcus genus (tuf), iii) Staphylococcus aureus (spa), iv) CoNS (cns), v) Panton-Valentine leukocidin (pvl), vi) methicillin resistance (mecA), and vii) vancomycin resistance (vanA). Following successful validation using 255 reference bacterial strains, applicability to analyse clinical samples was evaluated by direct amplification in spiked blood cultures (n = 89) which returned 100 % specificity, negative and positive predictive values. The new assay has LoD of 1.0x10(3) CFU/mL for the 16S rRNA marker and 1.0x10(4) CFU/mL for six other markers and completes cycling in less than one hour.

Conclusion: The speed, sensitivity (100 %), NPV (100 %) and PPV (100 %) suggest the new heptaplex PCR assay could be easily integrated into a routine diagnostic microbiology workflow. Detection of the cns marker allows for unique identification of CoNS in mono-microbial and in poly-microbial samples containing mixtures of CoNS and S. aureus without recourse to the conventional elimination approach which is ambiguous. In addition to the SA-CoNS differential diagnostic essence of the new assay, inclusion of vanA primers will allow microbiology laboratories to stay ahead of the emerging MRSA-VRSA evolution. To the best of our knowledge, the new heptaplex PCR assay is the most multiplexed among similar PCR-based assays for simultaneous detection of STAAR.

No MeSH data available.


Related in: MedlinePlus