Limits...
A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish.

Radev Z, Hermel JM, Elipot Y, Bretaud S, Arnould S, Duchateau P, Ruggiero F, Joly JS, Sohm F - PLoS ONE (2015)

Bottom Line: We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA.These symptoms worsened with ageing as described in patients with collagen VI deficiency.Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders.

View Article: PubMed Central - PubMed

Affiliation: UMS 1374, AMAGEN, INRA, Jouy en Josas, Domaine de Vilvert, France; UMS 3504, AMAGEN, CNRS, Gif-sur-Yvette, France.

ABSTRACT
Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders.

No MeSH data available.


Related in: MedlinePlus

Organization of the targeted locus and validation of the presence of alternatively spliced col6a1 mRNA in the mutants.(A) Organization of the genomic locus surrounding the col6a1 exon 14. Scale in kb is shown on the left-hand side. Exons 10 to 19 are represented by vertical dashes. Introns are symbolized by a continuous line. Genotyping primers gp1 and gp2 are represented on top. (B) The mRNA structures of wild type (WT, 298 bp) and exon 14-skipped forms (244 bp) are represented. The scheme represents the mRNA with exon skipping of the mutant M2 (deleted bases are symbolized by stars). Exons are boxed. (C) Table of transmission of mutated alleles for the F0 founders 3, 4 and 10. The numbers of genotyped adult F1 fish, the number of times each different type of mutation (M1-M6) occurred and the counts for WT F1 fish are indicated. (D) Nucleotide sequence of the junction between exon and intron 14 and alignment of the mutations M1 to M6 targeted by the TALEN. Each deleted nucleotides is represented by a dash. The number of deleted bases is reported on the right-hand side of the alignment. M1 was an over-represented mutation (ORM) but was absent out of 5 males and 5 females wild type TU zebrafish (see S3 Fig). The col6a1ama605003 line was generated from the M3 mutation (star). (E) Results of RT-PCRs on fin clips of heterozygous F1 fish containing one of the corresponding mutations (as indicated). The 298 bp band corresponds to the wild-type allele of the mRNA, the 244 bp band to the mutated allele. RT-PCR from a wild type (WT) fish is shown on the right hand side.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4519248&req=5

pone.0133986.g003: Organization of the targeted locus and validation of the presence of alternatively spliced col6a1 mRNA in the mutants.(A) Organization of the genomic locus surrounding the col6a1 exon 14. Scale in kb is shown on the left-hand side. Exons 10 to 19 are represented by vertical dashes. Introns are symbolized by a continuous line. Genotyping primers gp1 and gp2 are represented on top. (B) The mRNA structures of wild type (WT, 298 bp) and exon 14-skipped forms (244 bp) are represented. The scheme represents the mRNA with exon skipping of the mutant M2 (deleted bases are symbolized by stars). Exons are boxed. (C) Table of transmission of mutated alleles for the F0 founders 3, 4 and 10. The numbers of genotyped adult F1 fish, the number of times each different type of mutation (M1-M6) occurred and the counts for WT F1 fish are indicated. (D) Nucleotide sequence of the junction between exon and intron 14 and alignment of the mutations M1 to M6 targeted by the TALEN. Each deleted nucleotides is represented by a dash. The number of deleted bases is reported on the right-hand side of the alignment. M1 was an over-represented mutation (ORM) but was absent out of 5 males and 5 females wild type TU zebrafish (see S3 Fig). The col6a1ama605003 line was generated from the M3 mutation (star). (E) Results of RT-PCRs on fin clips of heterozygous F1 fish containing one of the corresponding mutations (as indicated). The 298 bp band corresponds to the wild-type allele of the mRNA, the 244 bp band to the mutated allele. RT-PCR from a wild type (WT) fish is shown on the right hand side.

Mentions: PCRs encompassing the targeted region of col6a1 were performed using the GoTaq Flexi DNA polymerase (Promega) in standard 50 μl reactions with 1 μl lysate per reaction as template. The primers used were as follows: forward primer TGCCACCATGAAGAAGAGTG and reverse primer TCAGATGTGAGTTGCTCAGAC (gp1, gp2, Fig 3A). The size of the amplified sequence was 246 bp (see Fig 3). Specificity and concentration of the PCR product was verified on a 2.5% agarose gel in 0.5 x TBE containing ethidium bromide at a final concentration of 0.5 μg/mL.


A TALEN-Exon Skipping Design for a Bethlem Myopathy Model in Zebrafish.

Radev Z, Hermel JM, Elipot Y, Bretaud S, Arnould S, Duchateau P, Ruggiero F, Joly JS, Sohm F - PLoS ONE (2015)

Organization of the targeted locus and validation of the presence of alternatively spliced col6a1 mRNA in the mutants.(A) Organization of the genomic locus surrounding the col6a1 exon 14. Scale in kb is shown on the left-hand side. Exons 10 to 19 are represented by vertical dashes. Introns are symbolized by a continuous line. Genotyping primers gp1 and gp2 are represented on top. (B) The mRNA structures of wild type (WT, 298 bp) and exon 14-skipped forms (244 bp) are represented. The scheme represents the mRNA with exon skipping of the mutant M2 (deleted bases are symbolized by stars). Exons are boxed. (C) Table of transmission of mutated alleles for the F0 founders 3, 4 and 10. The numbers of genotyped adult F1 fish, the number of times each different type of mutation (M1-M6) occurred and the counts for WT F1 fish are indicated. (D) Nucleotide sequence of the junction between exon and intron 14 and alignment of the mutations M1 to M6 targeted by the TALEN. Each deleted nucleotides is represented by a dash. The number of deleted bases is reported on the right-hand side of the alignment. M1 was an over-represented mutation (ORM) but was absent out of 5 males and 5 females wild type TU zebrafish (see S3 Fig). The col6a1ama605003 line was generated from the M3 mutation (star). (E) Results of RT-PCRs on fin clips of heterozygous F1 fish containing one of the corresponding mutations (as indicated). The 298 bp band corresponds to the wild-type allele of the mRNA, the 244 bp band to the mutated allele. RT-PCR from a wild type (WT) fish is shown on the right hand side.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4519248&req=5

pone.0133986.g003: Organization of the targeted locus and validation of the presence of alternatively spliced col6a1 mRNA in the mutants.(A) Organization of the genomic locus surrounding the col6a1 exon 14. Scale in kb is shown on the left-hand side. Exons 10 to 19 are represented by vertical dashes. Introns are symbolized by a continuous line. Genotyping primers gp1 and gp2 are represented on top. (B) The mRNA structures of wild type (WT, 298 bp) and exon 14-skipped forms (244 bp) are represented. The scheme represents the mRNA with exon skipping of the mutant M2 (deleted bases are symbolized by stars). Exons are boxed. (C) Table of transmission of mutated alleles for the F0 founders 3, 4 and 10. The numbers of genotyped adult F1 fish, the number of times each different type of mutation (M1-M6) occurred and the counts for WT F1 fish are indicated. (D) Nucleotide sequence of the junction between exon and intron 14 and alignment of the mutations M1 to M6 targeted by the TALEN. Each deleted nucleotides is represented by a dash. The number of deleted bases is reported on the right-hand side of the alignment. M1 was an over-represented mutation (ORM) but was absent out of 5 males and 5 females wild type TU zebrafish (see S3 Fig). The col6a1ama605003 line was generated from the M3 mutation (star). (E) Results of RT-PCRs on fin clips of heterozygous F1 fish containing one of the corresponding mutations (as indicated). The 298 bp band corresponds to the wild-type allele of the mRNA, the 244 bp band to the mutated allele. RT-PCR from a wild type (WT) fish is shown on the right hand side.
Mentions: PCRs encompassing the targeted region of col6a1 were performed using the GoTaq Flexi DNA polymerase (Promega) in standard 50 μl reactions with 1 μl lysate per reaction as template. The primers used were as follows: forward primer TGCCACCATGAAGAAGAGTG and reverse primer TCAGATGTGAGTTGCTCAGAC (gp1, gp2, Fig 3A). The size of the amplified sequence was 246 bp (see Fig 3). Specificity and concentration of the PCR product was verified on a 2.5% agarose gel in 0.5 x TBE containing ethidium bromide at a final concentration of 0.5 μg/mL.

Bottom Line: We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA.These symptoms worsened with ageing as described in patients with collagen VI deficiency.Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders.

View Article: PubMed Central - PubMed

Affiliation: UMS 1374, AMAGEN, INRA, Jouy en Josas, Domaine de Vilvert, France; UMS 3504, AMAGEN, CNRS, Gif-sur-Yvette, France.

ABSTRACT
Presently, human collagen VI-related diseases such as Ullrich congenital muscular dystrophy (UCMD) and Bethlem myopathy (BM) remain incurable, emphasizing the need to unravel their etiology and improve their treatments. In UCMD, symptom onset occurs early, and both diseases aggravate with ageing. In zebrafish fry, morpholinos reproduced early UCMD and BM symptoms but did not allow to study the late phenotype. Here, we produced the first zebrafish line with the human mutation frequently found in collagen VI-related disorders such as UCMD and BM. We used a transcription activator-like effector nuclease (TALEN) to design the col6a1ama605003-line with a mutation within an essential splice donor site, in intron 14 of the col6a1 gene, which provoke an in-frame skipping of exon 14 in the processed mRNA. This mutation at a splice donor site is the first example of a template-independent modification of splicing induced in zebrafish using a targetable nuclease. This technique is readily expandable to other organisms and can be instrumental in other disease studies. Histological and ultrastructural analyzes of homozygous and heterozygous mutant fry and 3 months post-fertilization (mpf) fish revealed co-dominantly inherited abnormal myofibers with disorganized myofibrils, enlarged sarcoplasmic reticulum, altered mitochondria and misaligned sarcomeres. Locomotion analyzes showed hypoxia-response behavior in 9 mpf col6a1 mutant unseen in 3 mpf fish. These symptoms worsened with ageing as described in patients with collagen VI deficiency. Thus, the col6a1ama605003-line is the first adult zebrafish model of collagen VI-related diseases; it will be instrumental both for basic research and drug discovery assays focusing on this type of disorders.

No MeSH data available.


Related in: MedlinePlus