Limits...
Heterozygote of TAP1 Codon637 decreases susceptibility to HPV infection but increases susceptibility to esophageal cancer among the Kazakh populations.

Zou N, Yang L, Chen L, Li T, Jin T, Peng H, Zhang S, Wang D, Li R, Liu C, Jiang J, Wang L, Liang W, Hu J, Li S, Wu C, Cui X, Chen Y, Li F - J. Exp. Clin. Cancer Res. (2015)

Bottom Line: Heterozygote of TAP1 D637G had a significantly higher risk for developing EC (OR 1.626; 95 % CI 1.080-2.449).The odds ratio for HPV infection was significantly lower among carriers of TAP1 D637G polymorphism (OR 0.281; 95 % CI 0.144-0.551).Heterozygote of TAP1 D637G decreases susceptibility to HPV infection in patients with EC but increases susceptibility to EC among the Kazakh populations.

View Article: PubMed Central - PubMed

Affiliation: Department of Pathology and Key Laboratory for Xinjiang Endemic and Ethnic Diseases, Shihezi University School of Medicine, North 4th Road, Shihezi, Xinjiang, 832002, China. 243226393@qq.com.

ABSTRACT

Background: The role of human papillomavirus (HPV) may be involved in the development of esophageal cancer (EC) and the polymorphic immune response gene transporter associated with antigen processing (TAP) may be involved in HPV persistence and subsequent cancer carcinogenesis. The current study aims to provide association evidence for HPV with EC, to investigate TAP1 polymorphisms in EC and assess its association with HPV statuses and EC in Kazakhs.

Methods: The HPV genotypes in 361 patients with EC and 66 controls selected from Kazakh population were evaluated using PCR. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was performed to detect two SNPs of TAP1 in 150 cases comprised of 75 HPV(+) and 75 HPV(-) patients and 283 pure ethnic population of Kazakh and evaluate their associations with susceptibility to EC. A case-to-case comparison based on the genotyping results was conducted to address the function of TAP1 variants in the involvement of HPV.

Results: The presence of four HPV genotypes in EC tissues - including HPV 16, 18, 31, 45 - was significantly higher at 64.6 % than those in controls at 18.2 % (P < 0.001). Such presence was strongly associated with increased risk of EC (OR 8.196; 95 % CI 4.280-15.964). The infection of HPV16, and multi-infection of 16 and 18 significantly increase the risk for developing EC (OR 4.616, 95 % CI 2.099-10.151; and OR 6.029, 95 % CI 1.395-26.057 respectively). Heterozygote of TAP1 D637G had a significantly higher risk for developing EC (OR 1.626; 95 % CI 1.080-2.449). The odds ratio for HPV infection was significantly lower among carriers of TAP1 D637G polymorphism (OR 0.281; 95 % CI 0.144-0.551).

Conclusions: HPV infection exhibits a strong positive association with the risk of EC in Kazakhs. Heterozygote of TAP1 D637G decreases susceptibility to HPV infection in patients with EC but increases susceptibility to EC among the Kazakh populations.

No MeSH data available.


Related in: MedlinePlus

Sequencing map of the genotype for the TAP1 Codon333 polymorphism (a) and TAP1 Codon637 polymorphism (b)
© Copyright Policy - open-access
Related In: Results  -  Collection

License 1 - License 2
getmorefigures.php?uid=PMC4514451&req=5

Fig4: Sequencing map of the genotype for the TAP1 Codon333 polymorphism (a) and TAP1 Codon637 polymorphism (b)

Mentions: DNA was extracted from the paraffin sections and blood samples using standard proteinase K digestion and a tissue DNA extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The two previously documented polymorphisms in TAP1 coding regions are previously documented. The primers used in PCR to detect for Codon 333 were as follows: forward primer GCAGGTAACATC ATGTCTCG and Reverse primer: GACAGATTGTGGGGAGAAGC, and for Codon 637 were as follows: forward primer CAGTAGTCTTGCCTTTATCC and Reverse primer: ATGACTGCCTCACCTGT AAC. The PCR was carried out in 25 ml reaction mixture containing genomic 1 ml DNA, 2.5 ml 10 × PCR buffer (100 mM Tris, pH 7.8, 100 mM NaCl, 10 mM EDTA and 0.5 % SDS), 1.8 ml of 25 mM MgCl2, 0.5 ml of 10 mM dNTP each, 10 pmol primer and 1.5 U of Taq polymerase (Promega, Madison, WI, USA). The reaction was initially carried out at 94 °C for 2 min, followed by 35 rounds of thermal cycling were in the conditions: denaturation at 94 °C for 40 s, annealing at 57.5 °C for 40s, extension at 72 °C for 40 s and the final extension was carried out at 72 °C for 10 min. The terminator ready sequencin was performed in a total volume of 20 ml containing 8 ml of PCR product, 2.5 ml 10 × PCR buffer, the enzymes used were 7 U of Bcl1 and Acc1 for genotyping Codon 333 and Codon 637 respectively. Cycling conditions were as follows: initial denaturing 96 °C for 2 min, followed by 30 cycles at 94 °C for 10 s, 50 °C for 5 s and 60 °C for 4 min. Restriction enzyme digestion with Bcl1 and Acc1 (Promega, Madison, WI, USA) of the PCR product was carried out overnight and analyzed on a 3 % agarose gel. DNA products were visualized by ethidium bromide staining (Fig. 3). The −333A and −637A showed two fragments (homozygous for the allele −333A and −637A), while its homologue −333G and −637G was undigested and resulted in a single band (homozygous for allele −333G and −637G). The presence of all three fragments defined heterozygotic individuals. To confirm the accuracy of TAP1 I333V and D637G genotyping by PCR, 10 % DNA sequence of the PCR products was then identified by NCBI Blast (Fig. 4). A 100 % match was identified between the results of DNA sequence displayed in the Genbank and HPV genotype detected.Fig. 3


Heterozygote of TAP1 Codon637 decreases susceptibility to HPV infection but increases susceptibility to esophageal cancer among the Kazakh populations.

Zou N, Yang L, Chen L, Li T, Jin T, Peng H, Zhang S, Wang D, Li R, Liu C, Jiang J, Wang L, Liang W, Hu J, Li S, Wu C, Cui X, Chen Y, Li F - J. Exp. Clin. Cancer Res. (2015)

Sequencing map of the genotype for the TAP1 Codon333 polymorphism (a) and TAP1 Codon637 polymorphism (b)
© Copyright Policy - open-access
Related In: Results  -  Collection

License 1 - License 2
Show All Figures
getmorefigures.php?uid=PMC4514451&req=5

Fig4: Sequencing map of the genotype for the TAP1 Codon333 polymorphism (a) and TAP1 Codon637 polymorphism (b)
Mentions: DNA was extracted from the paraffin sections and blood samples using standard proteinase K digestion and a tissue DNA extraction kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The two previously documented polymorphisms in TAP1 coding regions are previously documented. The primers used in PCR to detect for Codon 333 were as follows: forward primer GCAGGTAACATC ATGTCTCG and Reverse primer: GACAGATTGTGGGGAGAAGC, and for Codon 637 were as follows: forward primer CAGTAGTCTTGCCTTTATCC and Reverse primer: ATGACTGCCTCACCTGT AAC. The PCR was carried out in 25 ml reaction mixture containing genomic 1 ml DNA, 2.5 ml 10 × PCR buffer (100 mM Tris, pH 7.8, 100 mM NaCl, 10 mM EDTA and 0.5 % SDS), 1.8 ml of 25 mM MgCl2, 0.5 ml of 10 mM dNTP each, 10 pmol primer and 1.5 U of Taq polymerase (Promega, Madison, WI, USA). The reaction was initially carried out at 94 °C for 2 min, followed by 35 rounds of thermal cycling were in the conditions: denaturation at 94 °C for 40 s, annealing at 57.5 °C for 40s, extension at 72 °C for 40 s and the final extension was carried out at 72 °C for 10 min. The terminator ready sequencin was performed in a total volume of 20 ml containing 8 ml of PCR product, 2.5 ml 10 × PCR buffer, the enzymes used were 7 U of Bcl1 and Acc1 for genotyping Codon 333 and Codon 637 respectively. Cycling conditions were as follows: initial denaturing 96 °C for 2 min, followed by 30 cycles at 94 °C for 10 s, 50 °C for 5 s and 60 °C for 4 min. Restriction enzyme digestion with Bcl1 and Acc1 (Promega, Madison, WI, USA) of the PCR product was carried out overnight and analyzed on a 3 % agarose gel. DNA products were visualized by ethidium bromide staining (Fig. 3). The −333A and −637A showed two fragments (homozygous for the allele −333A and −637A), while its homologue −333G and −637G was undigested and resulted in a single band (homozygous for allele −333G and −637G). The presence of all three fragments defined heterozygotic individuals. To confirm the accuracy of TAP1 I333V and D637G genotyping by PCR, 10 % DNA sequence of the PCR products was then identified by NCBI Blast (Fig. 4). A 100 % match was identified between the results of DNA sequence displayed in the Genbank and HPV genotype detected.Fig. 3

Bottom Line: Heterozygote of TAP1 D637G had a significantly higher risk for developing EC (OR 1.626; 95 % CI 1.080-2.449).The odds ratio for HPV infection was significantly lower among carriers of TAP1 D637G polymorphism (OR 0.281; 95 % CI 0.144-0.551).Heterozygote of TAP1 D637G decreases susceptibility to HPV infection in patients with EC but increases susceptibility to EC among the Kazakh populations.

View Article: PubMed Central - PubMed

Affiliation: Department of Pathology and Key Laboratory for Xinjiang Endemic and Ethnic Diseases, Shihezi University School of Medicine, North 4th Road, Shihezi, Xinjiang, 832002, China. 243226393@qq.com.

ABSTRACT

Background: The role of human papillomavirus (HPV) may be involved in the development of esophageal cancer (EC) and the polymorphic immune response gene transporter associated with antigen processing (TAP) may be involved in HPV persistence and subsequent cancer carcinogenesis. The current study aims to provide association evidence for HPV with EC, to investigate TAP1 polymorphisms in EC and assess its association with HPV statuses and EC in Kazakhs.

Methods: The HPV genotypes in 361 patients with EC and 66 controls selected from Kazakh population were evaluated using PCR. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was performed to detect two SNPs of TAP1 in 150 cases comprised of 75 HPV(+) and 75 HPV(-) patients and 283 pure ethnic population of Kazakh and evaluate their associations with susceptibility to EC. A case-to-case comparison based on the genotyping results was conducted to address the function of TAP1 variants in the involvement of HPV.

Results: The presence of four HPV genotypes in EC tissues - including HPV 16, 18, 31, 45 - was significantly higher at 64.6 % than those in controls at 18.2 % (P < 0.001). Such presence was strongly associated with increased risk of EC (OR 8.196; 95 % CI 4.280-15.964). The infection of HPV16, and multi-infection of 16 and 18 significantly increase the risk for developing EC (OR 4.616, 95 % CI 2.099-10.151; and OR 6.029, 95 % CI 1.395-26.057 respectively). Heterozygote of TAP1 D637G had a significantly higher risk for developing EC (OR 1.626; 95 % CI 1.080-2.449). The odds ratio for HPV infection was significantly lower among carriers of TAP1 D637G polymorphism (OR 0.281; 95 % CI 0.144-0.551).

Conclusions: HPV infection exhibits a strong positive association with the risk of EC in Kazakhs. Heterozygote of TAP1 D637G decreases susceptibility to HPV infection in patients with EC but increases susceptibility to EC among the Kazakh populations.

No MeSH data available.


Related in: MedlinePlus