Limits...
Salivirus in Children and Its Association with Childhood Acute Gastroenteritis: A Paired Case-Control Study.

Yu JM, Ao YY, Liu N, Li LL, Duan ZJ - PLoS ONE (2015)

Bottom Line: Results showed that salivirus was detected in 16 (3.5%) and 13 (2.8%) of the case and control samples, respectively; no differences in detection rates (p=0.571) or mean values of viral loads (p=0.400) were observed between the groups.Furthermore, complete genome sequence of a salivirus recovered from the feces of a child with diarrhea (i.e., SaliV-FHB) shared a 99% nucleotide identity with the sewage strain.In conclusion, a paired case-control study did not support a causative role for salivirus strains detected in this study with pediatric gastroenteritis.

View Article: PubMed Central - PubMed

Affiliation: Institute for Viral Diseases Control and Prevention, China CDC, Beijing, China.

ABSTRACT
Salivirus was recently discovered in children with gastroenteritis and in sewage. Though a causative role for salivirus in childhood gastroenteritis was suggested in the previous study, the relationship between salivirus and acute gastroenteritis has not yet been clearly clarified. The sewage strain reported by Ng, although represented by incomplete genome sequencing data, was distinct from previously reported saliviruses, and had not previously been detected in humans. A case-control study examining 461 paired stool samples from children with diarrhea and healthy controls (1:1) was conducted in this study. Also, common diarrheal viruses were detected and complete genome of a salivirus was determined. Results showed that salivirus was detected in 16 (3.5%) and 13 (2.8%) of the case and control samples, respectively; no differences in detection rates (p=0.571) or mean values of viral loads (p=0.400) were observed between the groups. Multivariate Cox regression revealed no association between salivirus and gastroenteritis (p=0.774). The data also demonstrated that salivirus infection did not exacerbate clinical symptoms of gastroenteritis in children. Furthermore, complete genome sequence of a salivirus recovered from the feces of a child with diarrhea (i.e., SaliV-FHB) shared a 99% nucleotide identity with the sewage strain. In conclusion, a paired case-control study did not support a causative role for salivirus strains detected in this study with pediatric gastroenteritis. This study also demonstrated that all known saliviruses can be detected in the feces of children with or without gastroenteritis.

No MeSH data available.


Related in: MedlinePlus

Compare of full genome sequences between SaliV-FHB and salivirus A and SaliV-SewBKK.P1 region of SaliV-FHB shared lowest nt identity to that of Salivirus A, while P1, P2 and P3 regions of SaliV-FHB shared 99% nt identities to those of SaliV-SewBKK. "ID" stands for identity.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4507861&req=5

pone.0130977.g003: Compare of full genome sequences between SaliV-FHB and salivirus A and SaliV-SewBKK.P1 region of SaliV-FHB shared lowest nt identity to that of Salivirus A, while P1, P2 and P3 regions of SaliV-FHB shared 99% nt identities to those of SaliV-SewBKK. "ID" stands for identity.

Mentions: The base usage of the SaliV-FHB genome was 17.54% A, 36.0% C, 21.44% G and 25.0% U, with a pyrimidine content of 61%, which is much higher compared with the other viruses of the Picornaviridae family (HPeV1: 47.1%; LV 145SL: 49.11%; SAFV: 51.0%; and SV19: 48.1%). BLASTn analysis revealed that the full genome of SaliV-FHB exhibited 99% shared nt identity with SaliV-SewBKK, with only 79% query coverage, and 83% shared nt identity with Salivirus A, with 99% query coverage. Further, P1 region of SaliV-FHB shared lowest nt identity to that of Salivirus A, while P1, P2 and P3 regions of SaliV-FHB all shared 99% nt identities to those of SaliV-SewBKK (Fig 3). Compared to other saliviruses, SaliV-FHB is characterized by a marked difference in the 5′ UTR: a redundant sequence of 21/22-bp length was observed (position 214/5-236bp; sequence: [C]TCTTTCTATCCGCCCTCACTT).


Salivirus in Children and Its Association with Childhood Acute Gastroenteritis: A Paired Case-Control Study.

Yu JM, Ao YY, Liu N, Li LL, Duan ZJ - PLoS ONE (2015)

Compare of full genome sequences between SaliV-FHB and salivirus A and SaliV-SewBKK.P1 region of SaliV-FHB shared lowest nt identity to that of Salivirus A, while P1, P2 and P3 regions of SaliV-FHB shared 99% nt identities to those of SaliV-SewBKK. "ID" stands for identity.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4507861&req=5

pone.0130977.g003: Compare of full genome sequences between SaliV-FHB and salivirus A and SaliV-SewBKK.P1 region of SaliV-FHB shared lowest nt identity to that of Salivirus A, while P1, P2 and P3 regions of SaliV-FHB shared 99% nt identities to those of SaliV-SewBKK. "ID" stands for identity.
Mentions: The base usage of the SaliV-FHB genome was 17.54% A, 36.0% C, 21.44% G and 25.0% U, with a pyrimidine content of 61%, which is much higher compared with the other viruses of the Picornaviridae family (HPeV1: 47.1%; LV 145SL: 49.11%; SAFV: 51.0%; and SV19: 48.1%). BLASTn analysis revealed that the full genome of SaliV-FHB exhibited 99% shared nt identity with SaliV-SewBKK, with only 79% query coverage, and 83% shared nt identity with Salivirus A, with 99% query coverage. Further, P1 region of SaliV-FHB shared lowest nt identity to that of Salivirus A, while P1, P2 and P3 regions of SaliV-FHB all shared 99% nt identities to those of SaliV-SewBKK (Fig 3). Compared to other saliviruses, SaliV-FHB is characterized by a marked difference in the 5′ UTR: a redundant sequence of 21/22-bp length was observed (position 214/5-236bp; sequence: [C]TCTTTCTATCCGCCCTCACTT).

Bottom Line: Results showed that salivirus was detected in 16 (3.5%) and 13 (2.8%) of the case and control samples, respectively; no differences in detection rates (p=0.571) or mean values of viral loads (p=0.400) were observed between the groups.Furthermore, complete genome sequence of a salivirus recovered from the feces of a child with diarrhea (i.e., SaliV-FHB) shared a 99% nucleotide identity with the sewage strain.In conclusion, a paired case-control study did not support a causative role for salivirus strains detected in this study with pediatric gastroenteritis.

View Article: PubMed Central - PubMed

Affiliation: Institute for Viral Diseases Control and Prevention, China CDC, Beijing, China.

ABSTRACT
Salivirus was recently discovered in children with gastroenteritis and in sewage. Though a causative role for salivirus in childhood gastroenteritis was suggested in the previous study, the relationship between salivirus and acute gastroenteritis has not yet been clearly clarified. The sewage strain reported by Ng, although represented by incomplete genome sequencing data, was distinct from previously reported saliviruses, and had not previously been detected in humans. A case-control study examining 461 paired stool samples from children with diarrhea and healthy controls (1:1) was conducted in this study. Also, common diarrheal viruses were detected and complete genome of a salivirus was determined. Results showed that salivirus was detected in 16 (3.5%) and 13 (2.8%) of the case and control samples, respectively; no differences in detection rates (p=0.571) or mean values of viral loads (p=0.400) were observed between the groups. Multivariate Cox regression revealed no association between salivirus and gastroenteritis (p=0.774). The data also demonstrated that salivirus infection did not exacerbate clinical symptoms of gastroenteritis in children. Furthermore, complete genome sequence of a salivirus recovered from the feces of a child with diarrhea (i.e., SaliV-FHB) shared a 99% nucleotide identity with the sewage strain. In conclusion, a paired case-control study did not support a causative role for salivirus strains detected in this study with pediatric gastroenteritis. This study also demonstrated that all known saliviruses can be detected in the feces of children with or without gastroenteritis.

No MeSH data available.


Related in: MedlinePlus