Limits...
CFTR expression from a BAC carrying the complete human gene and associated regulatory elements.

Kotzamanis G, Abdulrazzak H, Gifford-Garner J, Haussecker PL, Cheung W, Grillot-Courvalin C, Harris A, Kittas C, Kotsinas A, Gorgoulis VG, Huxley C - J. Cell. Mol. Med. (2008)

Bottom Line: We have used Red homologous recombination to add a to a previously described vector to construct a new BAC vector with a 250.3-kb insert containing the whole coding region of the CFTR gene along with 40.1 kb of DNA 5' to the gene and 25 kb 3' to the gene.We evaluated expression by RT-PCR in CMT-93 cells and showed that the gene is expressed both from integrated copies of the BAC and also from episomes carrying the oriP/EBNA-1 element.Sequencing of the human CFTR mRNA from one clone showed that the BAC is functional and can generate correctly spliced mRNA in the mouse background.

View Article: PubMed Central - PubMed

Affiliation: Department of Histology and Embryology, School of Medicine, University of Athens, Athens, Greece. geokotz@med.uoa.gr

ABSTRACT
The use of genomic DNA rather than cDNA or mini-gene constructs in gene therapy might be advantageous as these contain intronic and long-range control elements vital for accurate expression. For gene therapy of cystic fibrosis though, no bacterial artificial chromosome (BAC), containing the whole CFTR gene is available. We have used Red homologous recombination to add a to a previously described vector to construct a new BAC vector with a 250.3-kb insert containing the whole coding region of the CFTR gene along with 40.1 kb of DNA 5' to the gene and 25 kb 3' to the gene. This includes all the known control elements of the gene. We evaluated expression by RT-PCR in CMT-93 cells and showed that the gene is expressed both from integrated copies of the BAC and also from episomes carrying the oriP/EBNA-1 element. Sequencing of the human CFTR mRNA from one clone showed that the BAC is functional and can generate correctly spliced mRNA in the mouse background. The BAC described here is the only CFTR genomic construct available on a convenient vector that can be readily used for gene expression studies or in vivo studies to test its potential application in gene therapy for cystic fibrosis.

Show MeSH

Related in: MedlinePlus

Recombination strategy for the construction of CFTR1, 2, 3 and CFTR1, 2, 3 OE BACs. The primers used to check each recombination event are indicated as arrows labelled 1 to 11. The sizes of the fragments after digestion with Nru I +Sal I are indicated for CFTR1, 2, 3 and CFTR1, 2, 3 OE BACs.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC4498948&req=5

fig01: Recombination strategy for the construction of CFTR1, 2, 3 and CFTR1, 2, 3 OE BACs. The primers used to check each recombination event are indicated as arrows labelled 1 to 11. The sizes of the fragments after digestion with Nru I +Sal I are indicated for CFTR1, 2, 3 and CFTR1, 2, 3 OE BACs.

Mentions: For the modification of BAC 205G13, the pBlSHomABeloHomOSloxZeo vector was constructed (Fig. 1). Initially, HomA was amplified from BAC 68P20 (32) by PCR using primers HomA’L: 5′ATTTGTCGACCAAGAGCCTCTGTCACCACA and HomA’R: 5′ATTTGGATCCATTGCACATGGGCACTAACA and cloned into BamH I +Sal I cut pBlS1 [34] to give pBlS1HomA. At the same time pBlS2Belo [34] was modified by digesting it with I-Ppo I and Not I and ligating it to a pair of complementary synthetic oligonucleotides, 2modL: 5′GTGAGCGAATTCATATCTCGAGATCCGCGGGC and 2modR 5′ GGCCGCCCGCGGATATCTCGCGATATGAATTCGCTCACTTAA to give pBlS2BeloMod with the I-Ppo I site destroyed, the Cla I site replaced by an EcoR I site and the order of Sac II and Xho I sites reversed. The ZeoR gene was then excised from pSV40Zeo (Invitrogen, Paisley, UK) as a 1-kb EcoR I-Xho I fragment and cloned into EcoR I +Xho I cut pBlS2BeloMod to give pBlSBeloZeo. HomOS was amplified from BAC 205G13 by PCR using primers HomOSL: 5′ATTTCTCGAGAGATAACTTCGTATAATGTATGCTATACGAAG TTATGCATCCAGTTCCAA (that includes the sequence of a loxP site)(6556-6568 of BAC 205G13) and HomOSR: 5′ATTTCCGCGGAGGCTGCAAATCAGCCTAA (7562-7543 of BAC 205G13) and cloned into Xho I +Sac I cut pBlS2BeloZeo to give pBlS2BeloZeoHomSlox. This plasmid was then digested with Sal I +Sac I and the 6.6-kb fragment was purified and cloned into Xho I +Sac I cut pBlS1HomA to give pBlSHomABeloHomOSloxZeo.


CFTR expression from a BAC carrying the complete human gene and associated regulatory elements.

Kotzamanis G, Abdulrazzak H, Gifford-Garner J, Haussecker PL, Cheung W, Grillot-Courvalin C, Harris A, Kittas C, Kotsinas A, Gorgoulis VG, Huxley C - J. Cell. Mol. Med. (2008)

Recombination strategy for the construction of CFTR1, 2, 3 and CFTR1, 2, 3 OE BACs. The primers used to check each recombination event are indicated as arrows labelled 1 to 11. The sizes of the fragments after digestion with Nru I +Sal I are indicated for CFTR1, 2, 3 and CFTR1, 2, 3 OE BACs.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC4498948&req=5

fig01: Recombination strategy for the construction of CFTR1, 2, 3 and CFTR1, 2, 3 OE BACs. The primers used to check each recombination event are indicated as arrows labelled 1 to 11. The sizes of the fragments after digestion with Nru I +Sal I are indicated for CFTR1, 2, 3 and CFTR1, 2, 3 OE BACs.
Mentions: For the modification of BAC 205G13, the pBlSHomABeloHomOSloxZeo vector was constructed (Fig. 1). Initially, HomA was amplified from BAC 68P20 (32) by PCR using primers HomA’L: 5′ATTTGTCGACCAAGAGCCTCTGTCACCACA and HomA’R: 5′ATTTGGATCCATTGCACATGGGCACTAACA and cloned into BamH I +Sal I cut pBlS1 [34] to give pBlS1HomA. At the same time pBlS2Belo [34] was modified by digesting it with I-Ppo I and Not I and ligating it to a pair of complementary synthetic oligonucleotides, 2modL: 5′GTGAGCGAATTCATATCTCGAGATCCGCGGGC and 2modR 5′ GGCCGCCCGCGGATATCTCGCGATATGAATTCGCTCACTTAA to give pBlS2BeloMod with the I-Ppo I site destroyed, the Cla I site replaced by an EcoR I site and the order of Sac II and Xho I sites reversed. The ZeoR gene was then excised from pSV40Zeo (Invitrogen, Paisley, UK) as a 1-kb EcoR I-Xho I fragment and cloned into EcoR I +Xho I cut pBlS2BeloMod to give pBlSBeloZeo. HomOS was amplified from BAC 205G13 by PCR using primers HomOSL: 5′ATTTCTCGAGAGATAACTTCGTATAATGTATGCTATACGAAG TTATGCATCCAGTTCCAA (that includes the sequence of a loxP site)(6556-6568 of BAC 205G13) and HomOSR: 5′ATTTCCGCGGAGGCTGCAAATCAGCCTAA (7562-7543 of BAC 205G13) and cloned into Xho I +Sac I cut pBlS2BeloZeo to give pBlS2BeloZeoHomSlox. This plasmid was then digested with Sal I +Sac I and the 6.6-kb fragment was purified and cloned into Xho I +Sac I cut pBlS1HomA to give pBlSHomABeloHomOSloxZeo.

Bottom Line: We have used Red homologous recombination to add a to a previously described vector to construct a new BAC vector with a 250.3-kb insert containing the whole coding region of the CFTR gene along with 40.1 kb of DNA 5' to the gene and 25 kb 3' to the gene.We evaluated expression by RT-PCR in CMT-93 cells and showed that the gene is expressed both from integrated copies of the BAC and also from episomes carrying the oriP/EBNA-1 element.Sequencing of the human CFTR mRNA from one clone showed that the BAC is functional and can generate correctly spliced mRNA in the mouse background.

View Article: PubMed Central - PubMed

Affiliation: Department of Histology and Embryology, School of Medicine, University of Athens, Athens, Greece. geokotz@med.uoa.gr

ABSTRACT
The use of genomic DNA rather than cDNA or mini-gene constructs in gene therapy might be advantageous as these contain intronic and long-range control elements vital for accurate expression. For gene therapy of cystic fibrosis though, no bacterial artificial chromosome (BAC), containing the whole CFTR gene is available. We have used Red homologous recombination to add a to a previously described vector to construct a new BAC vector with a 250.3-kb insert containing the whole coding region of the CFTR gene along with 40.1 kb of DNA 5' to the gene and 25 kb 3' to the gene. This includes all the known control elements of the gene. We evaluated expression by RT-PCR in CMT-93 cells and showed that the gene is expressed both from integrated copies of the BAC and also from episomes carrying the oriP/EBNA-1 element. Sequencing of the human CFTR mRNA from one clone showed that the BAC is functional and can generate correctly spliced mRNA in the mouse background. The BAC described here is the only CFTR genomic construct available on a convenient vector that can be readily used for gene expression studies or in vivo studies to test its potential application in gene therapy for cystic fibrosis.

Show MeSH
Related in: MedlinePlus