Limits...
GntR Family of Bacterial Transcription Factors and Their DNA Binding Motifs: Structure, Positioning and Co-Evolution.

Suvorova IA, Korostelev YD, Gelfand MS - PLoS ONE (2015)

Bottom Line: We also analyze the divergon structure and preferred site positions relative to regulated genes in the FADR and HUTC subfamilies.A single site in a divergon usually regulates both operons and is approximately in the middle of the intergenic area.Double sites are either involved in the co-operative regulation of both operons and then are in the center of the intergenic area, or each site in the pair independently regulates its own operon and tends to be near it.

View Article: PubMed Central - PubMed

Affiliation: Research and Training Center on Bioinformatics, Institute for Information Transmission Problems RAS (The Kharkevich Institute), Moscow, Russia.

ABSTRACT
The GNTR family of transcription factors (TFs) is a large group of proteins present in diverse bacteria and regulating various biological processes. Here we use the comparative genomics approach to reconstruct regulons and identify binding motifs of regulators from three subfamilies of the GNTR family, FADR, HUTC, and YTRA. Using these data, we attempt to predict DNA-protein contacts by analyzing correlations between binding motifs in DNA and amino acid sequences of TFs. We identify pairs of positions with high correlation between amino acids and nucleotides for FADR, HUTC, and YTRA subfamilies and show that the most predicted DNA-protein interactions are quite similar in all subfamilies and conform well to the experimentally identified contacts formed by FadR from E. coli and AraR from B. subtilis. The most frequent predicted contacts in the analyzed subfamilies are Arg-G, Asn-A, Asp-C. We also analyze the divergon structure and preferred site positions relative to regulated genes in the FADR and HUTC subfamilies. A single site in a divergon usually regulates both operons and is approximately in the middle of the intergenic area. Double sites are either involved in the co-operative regulation of both operons and then are in the center of the intergenic area, or each site in the pair independently regulates its own operon and tends to be near it. We also identify additional candidate TF-binding boxes near palindromic binding sites of TFs from the FADR, HUTC, and YTRA subfamilies, which may play role in the binding of additional TF-subunits.

No MeSH data available.


Related in: MedlinePlus

Heat map of correlations between amino acids and nucleotides for HutC-subfamily TFs and their binding sites.Notation as in Fig 1.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4494728&req=5

pone.0132618.g002: Heat map of correlations between amino acids and nucleotides for HutC-subfamily TFs and their binding sites.Notation as in Fig 1.

Mentions: The consensus sequence of all analyzed binding motifs of HutC-subfamily TFs is very similar to the one of the FadR subfamily (Fig 2). The distance between GT and AC in most HutC-subfamily TF binding sites is 4 nt. Among the exceptions there are FarR (direct repeats TGTATTAWTT) [35], NagQ (direct repeats TGGTATT) [30], SdhR (palindrome with additional symmetry TCTTATGTCTTATATAAGACATAAGA) [56]. These TFs were excluded from the correlation analysis, as their binding sites could not be aligned and compared with the main group of sites (Spreadsheet HutC in S1 File).


GntR Family of Bacterial Transcription Factors and Their DNA Binding Motifs: Structure, Positioning and Co-Evolution.

Suvorova IA, Korostelev YD, Gelfand MS - PLoS ONE (2015)

Heat map of correlations between amino acids and nucleotides for HutC-subfamily TFs and their binding sites.Notation as in Fig 1.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4494728&req=5

pone.0132618.g002: Heat map of correlations between amino acids and nucleotides for HutC-subfamily TFs and their binding sites.Notation as in Fig 1.
Mentions: The consensus sequence of all analyzed binding motifs of HutC-subfamily TFs is very similar to the one of the FadR subfamily (Fig 2). The distance between GT and AC in most HutC-subfamily TF binding sites is 4 nt. Among the exceptions there are FarR (direct repeats TGTATTAWTT) [35], NagQ (direct repeats TGGTATT) [30], SdhR (palindrome with additional symmetry TCTTATGTCTTATATAAGACATAAGA) [56]. These TFs were excluded from the correlation analysis, as their binding sites could not be aligned and compared with the main group of sites (Spreadsheet HutC in S1 File).

Bottom Line: We also analyze the divergon structure and preferred site positions relative to regulated genes in the FADR and HUTC subfamilies.A single site in a divergon usually regulates both operons and is approximately in the middle of the intergenic area.Double sites are either involved in the co-operative regulation of both operons and then are in the center of the intergenic area, or each site in the pair independently regulates its own operon and tends to be near it.

View Article: PubMed Central - PubMed

Affiliation: Research and Training Center on Bioinformatics, Institute for Information Transmission Problems RAS (The Kharkevich Institute), Moscow, Russia.

ABSTRACT
The GNTR family of transcription factors (TFs) is a large group of proteins present in diverse bacteria and regulating various biological processes. Here we use the comparative genomics approach to reconstruct regulons and identify binding motifs of regulators from three subfamilies of the GNTR family, FADR, HUTC, and YTRA. Using these data, we attempt to predict DNA-protein contacts by analyzing correlations between binding motifs in DNA and amino acid sequences of TFs. We identify pairs of positions with high correlation between amino acids and nucleotides for FADR, HUTC, and YTRA subfamilies and show that the most predicted DNA-protein interactions are quite similar in all subfamilies and conform well to the experimentally identified contacts formed by FadR from E. coli and AraR from B. subtilis. The most frequent predicted contacts in the analyzed subfamilies are Arg-G, Asn-A, Asp-C. We also analyze the divergon structure and preferred site positions relative to regulated genes in the FADR and HUTC subfamilies. A single site in a divergon usually regulates both operons and is approximately in the middle of the intergenic area. Double sites are either involved in the co-operative regulation of both operons and then are in the center of the intergenic area, or each site in the pair independently regulates its own operon and tends to be near it. We also identify additional candidate TF-binding boxes near palindromic binding sites of TFs from the FADR, HUTC, and YTRA subfamilies, which may play role in the binding of additional TF-subunits.

No MeSH data available.


Related in: MedlinePlus