Limits...
Novel Polymorphic Microsatellite Markers Reveal Genetic Differentiation between Two Sympatric Types of Galaxea fascicularis.

Nakajima Y, Shinzato C, Satoh N, Mitarai S - PLoS ONE (2015)

Bottom Line: Bayesian clustering also indicated that these two types are genetically isolated.While nuclear microsatellite genotypes also showed genetic differentiation between mitochondrial types, the mechanism of divergence is not yet clear.These markers will be useful to estimate genetic diversity, differentiation, and connectivity among populations, and to understand evolutionary processes, including divergence of types in G. fascicularis.

View Article: PubMed Central - PubMed

Affiliation: Marine Biophysics Unit, Okinawa Institute of Science and Technology Graduate University, Onna, Okinawa, Japan.

ABSTRACT
The reef-building, scleractinian coral, Galaxea fascicularis, is classified into soft and hard types, based on nematocyst morphology. This character is correlated with the length of the mitochondrial non-coding region (mt-Long: soft colony type, and nematocysts with wide capsules and long shafts; mt-Short: hard colony type, and nematocysts with thin capsules and short shafts). We isolated and characterized novel polymorphic microsatellite markers for G. fascicularis using next-generation sequencing. Based upon the mitochondrial non-coding region, 53 of the 97 colonies collected were mt-Long (mt-L) and 44 were mt-Short (mt-S). Among the 53 mt-L colonies, 27 loci were identified as amplifiable, polymorphic microsatellite loci, devoid of somatic mutations and free of scoring errors. Eleven of those 27 loci were also amplifiable and polymorphic in the 44 mt-S colonies; these 11 are cross-type microsatellite loci. The other 16 loci were considered useful only for mt-L colonies. These 27 loci identified 10 multilocus lineages (MLLs) among the 53 mt-L colonies (NMLL/N = 0.189), and the 11 cross-type loci identified 7 MLLs in 44 mt-S colonies (NMLL/N = 0.159). Significant genetic differentiation between the two types was detected based on the genetic differentiation index (FST = 0.080, P = 0.001). Bayesian clustering also indicated that these two types are genetically isolated. While nuclear microsatellite genotypes also showed genetic differentiation between mitochondrial types, the mechanism of divergence is not yet clear. These markers will be useful to estimate genetic diversity, differentiation, and connectivity among populations, and to understand evolutionary processes, including divergence of types in G. fascicularis.

No MeSH data available.


Related in: MedlinePlus

Photograph (upper left) and map showing the sampling location for Galaxea fascicularis.Zampa is located on Okinawa Island, Japan.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4492964&req=5

pone.0130176.g001: Photograph (upper left) and map showing the sampling location for Galaxea fascicularis.Zampa is located on Okinawa Island, Japan.

Mentions: To characterize microsatellite loci, we screened 97 colonies of G. fascicularis collected randomly at Zampa, Okinawa Island (26°26′20″N/127°42′40″E) (Fig 1). Color morphs were ignored in this study, because they are not correlated with mitochondrial type [8, 11]. Samples were preserved in ethanol and brought to the laboratory, where genomic DNA was extracted using a DNeasy Blood & Tissue kit (Qiagen). To analyze polymorphism and amplification of designed primer sets and to identify mitochondrial types, we used the tailed primer method to perform PCR. The reaction mixture (5 μL) contained template DNA (< 100 ng), AmpliTaq Gold 360 Master Mix (Qiagen), and three primers for each locus: a non-tailed forward primer (0.2 μM), a reverse primer with a U19 sequence tail (0.2 μM), and a U19 (5’-GGTTTTCCCAGTCACGACG-3’) primer (0.5 μM) fluorescently labeled with FAM, VIC, NED, or PET, based on the method by Schuelke [16]. Furthermore, 188–1 (5’- GAATAGGGTATACTAGCAGGTC -3’, see [7]), 188-R3-U19 (5’- GGTTTTCCCAGTCACGACGCATCATTATCCTCTTCAAGG -3’), and U19 primer fluorescently labeled with FAM were used for identification of mitochondrial types (mt-L or mt-S) based upon the non-coding region between cyt b and nad 2. Amplifications were carried out under the following conditions: 95°C for 9 min; followed by 35 cycles at 95°C for 30 s, 54°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 5 min. Amplified PCR products with an added internal size standard (GeneScan 600 LIZ; Applied Biosystems) were analyzed using an automated, capillary-based DNA sequencer, ABI 3130xl Genetic Analyzer (Applied Biosystems), and GeneMapper ver. 3.7 (Applied Biosystems). Loci showing non-amplification or multiple non-specific peaks were excluded from further analysis. Furthermore, loci with little polymorphism or few heterozygotes (e.g., almost all colonies were homozygous) were also excluded.


Novel Polymorphic Microsatellite Markers Reveal Genetic Differentiation between Two Sympatric Types of Galaxea fascicularis.

Nakajima Y, Shinzato C, Satoh N, Mitarai S - PLoS ONE (2015)

Photograph (upper left) and map showing the sampling location for Galaxea fascicularis.Zampa is located on Okinawa Island, Japan.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4492964&req=5

pone.0130176.g001: Photograph (upper left) and map showing the sampling location for Galaxea fascicularis.Zampa is located on Okinawa Island, Japan.
Mentions: To characterize microsatellite loci, we screened 97 colonies of G. fascicularis collected randomly at Zampa, Okinawa Island (26°26′20″N/127°42′40″E) (Fig 1). Color morphs were ignored in this study, because they are not correlated with mitochondrial type [8, 11]. Samples were preserved in ethanol and brought to the laboratory, where genomic DNA was extracted using a DNeasy Blood & Tissue kit (Qiagen). To analyze polymorphism and amplification of designed primer sets and to identify mitochondrial types, we used the tailed primer method to perform PCR. The reaction mixture (5 μL) contained template DNA (< 100 ng), AmpliTaq Gold 360 Master Mix (Qiagen), and three primers for each locus: a non-tailed forward primer (0.2 μM), a reverse primer with a U19 sequence tail (0.2 μM), and a U19 (5’-GGTTTTCCCAGTCACGACG-3’) primer (0.5 μM) fluorescently labeled with FAM, VIC, NED, or PET, based on the method by Schuelke [16]. Furthermore, 188–1 (5’- GAATAGGGTATACTAGCAGGTC -3’, see [7]), 188-R3-U19 (5’- GGTTTTCCCAGTCACGACGCATCATTATCCTCTTCAAGG -3’), and U19 primer fluorescently labeled with FAM were used for identification of mitochondrial types (mt-L or mt-S) based upon the non-coding region between cyt b and nad 2. Amplifications were carried out under the following conditions: 95°C for 9 min; followed by 35 cycles at 95°C for 30 s, 54°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 5 min. Amplified PCR products with an added internal size standard (GeneScan 600 LIZ; Applied Biosystems) were analyzed using an automated, capillary-based DNA sequencer, ABI 3130xl Genetic Analyzer (Applied Biosystems), and GeneMapper ver. 3.7 (Applied Biosystems). Loci showing non-amplification or multiple non-specific peaks were excluded from further analysis. Furthermore, loci with little polymorphism or few heterozygotes (e.g., almost all colonies were homozygous) were also excluded.

Bottom Line: Bayesian clustering also indicated that these two types are genetically isolated.While nuclear microsatellite genotypes also showed genetic differentiation between mitochondrial types, the mechanism of divergence is not yet clear.These markers will be useful to estimate genetic diversity, differentiation, and connectivity among populations, and to understand evolutionary processes, including divergence of types in G. fascicularis.

View Article: PubMed Central - PubMed

Affiliation: Marine Biophysics Unit, Okinawa Institute of Science and Technology Graduate University, Onna, Okinawa, Japan.

ABSTRACT
The reef-building, scleractinian coral, Galaxea fascicularis, is classified into soft and hard types, based on nematocyst morphology. This character is correlated with the length of the mitochondrial non-coding region (mt-Long: soft colony type, and nematocysts with wide capsules and long shafts; mt-Short: hard colony type, and nematocysts with thin capsules and short shafts). We isolated and characterized novel polymorphic microsatellite markers for G. fascicularis using next-generation sequencing. Based upon the mitochondrial non-coding region, 53 of the 97 colonies collected were mt-Long (mt-L) and 44 were mt-Short (mt-S). Among the 53 mt-L colonies, 27 loci were identified as amplifiable, polymorphic microsatellite loci, devoid of somatic mutations and free of scoring errors. Eleven of those 27 loci were also amplifiable and polymorphic in the 44 mt-S colonies; these 11 are cross-type microsatellite loci. The other 16 loci were considered useful only for mt-L colonies. These 27 loci identified 10 multilocus lineages (MLLs) among the 53 mt-L colonies (NMLL/N = 0.189), and the 11 cross-type loci identified 7 MLLs in 44 mt-S colonies (NMLL/N = 0.159). Significant genetic differentiation between the two types was detected based on the genetic differentiation index (FST = 0.080, P = 0.001). Bayesian clustering also indicated that these two types are genetically isolated. While nuclear microsatellite genotypes also showed genetic differentiation between mitochondrial types, the mechanism of divergence is not yet clear. These markers will be useful to estimate genetic diversity, differentiation, and connectivity among populations, and to understand evolutionary processes, including divergence of types in G. fascicularis.

No MeSH data available.


Related in: MedlinePlus