Limits...
Production of Cloned Miniature Pigs Expressing High Levels of Human Apolipoprotein(a) in Plasma.

Ozawa M, Himaki T, Ookutsu S, Mizobe Y, Ogawa J, Miyoshi K, Yabuki A, Fan J, Yoshida M - PLoS ONE (2015)

Bottom Line: However, because apolipoprotein(a) [apo(a)], the unique component of Lp(a), is found only in primates and humans, the study of human Lp(a) has been hampered due to the lack of appropriate animal models.Immunohistochemical analysis of tissue sections and RT-PCR analysis of total RNA from organs of cloned piglet revealed that apo(a) is expressed in various tissues/organs including heart, liver, kidney, and intestine.More importantly, a transgenic line exhibited a high level (>400 mg/dL) of Lp(a) in plasma, and the transgenic apo(a) gene was transmitted to the offspring.

View Article: PubMed Central - PubMed

Affiliation: Department of Biochemistry and Molecular Biology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan.

ABSTRACT
High lipoprotein(a) [Lp(a)] levels are a major risk factor for the development of atherosclerosis. However, because apolipoprotein(a) [apo(a)], the unique component of Lp(a), is found only in primates and humans, the study of human Lp(a) has been hampered due to the lack of appropriate animal models. Using somatic cell nuclear transfer (SCNT) techniques, we produced transgenic miniature pigs expressing human apo(a) in the plasma. First, we placed the hemagglutinin (HA)-tagged cDNA of human apo(a) under the control of the β-actin promoter and cytomegalovirus enhancer, and then introduced this construct into kidney epithelial cells. Immunostaining of cells with anti-HA antibody allowed identification of cells stably expressing apo(a); one of the positive clones was used to provide donor cells for SCNT, yielding blastocysts that expressed apo(a). Immunohistochemical analysis of tissue sections and RT-PCR analysis of total RNA from organs of cloned piglet revealed that apo(a) is expressed in various tissues/organs including heart, liver, kidney, and intestine. More importantly, a transgenic line exhibited a high level (>400 mg/dL) of Lp(a) in plasma, and the transgenic apo(a) gene was transmitted to the offspring. Thus, we generated a human apo(a)-transgenic miniature pig that can be used as a model system to study advanced atherosclerosis related to human disease. The anatomical and physiological similarities between the swine and human cardiovascular systems will make this pig model a valuable source of information on the role of apo(a) in the formation of atherosclerosis, as well as the mechanisms underlying vascular health and disease.

No MeSH data available.


Related in: MedlinePlus

Isolation of pig kidney epithelial cells stably expressing human apo(a).A, schematic representation of the pC-apo(a)HA construct. The vector contains the CAG promoter, HA-tagged apo(a) gene, β-globin polyadenylation signal (polyA), and neo gene under the control of herpes simplex virus thymidine kinase (tk) promoter. B, stable transfectants of MDCK cells expressing HA-tagged human apo(a) or HA-tagged E-cadherin (Ecad) were immunostained with anti-HA monoclonal antibody, followed by rhodamine-conjugated anti-rat IgG. Note the punctate staining of HA fluorescent signals that correspond to ER in apo(a)-expressing cells and the membrane staining of the cell–cell contact sites in E-cadherin (a cell–cell adhesion molecule)-expressing cells. Bar, 25 μm. C, Stably transfected pig kidney epithelial cells expressing human apo(a) were immunostained with anti-HA monoclonal antibody. Note the ER staining. Bar, 25 μm. D, Total cell lysates of parental pig kidney epithelial (PKE) cells or stable transfectants [apo(a)+] were subjected to immunoblot analysis with anti-HA antibody. E, Conditioned medium of PKE or apo(a)+ cells were subjected to immunoprecipitation with anti-HA antibody. Collected materials were subjected to immunoblot analysis with anti-apo(a) antibody.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4492603&req=5

pone.0132155.g001: Isolation of pig kidney epithelial cells stably expressing human apo(a).A, schematic representation of the pC-apo(a)HA construct. The vector contains the CAG promoter, HA-tagged apo(a) gene, β-globin polyadenylation signal (polyA), and neo gene under the control of herpes simplex virus thymidine kinase (tk) promoter. B, stable transfectants of MDCK cells expressing HA-tagged human apo(a) or HA-tagged E-cadherin (Ecad) were immunostained with anti-HA monoclonal antibody, followed by rhodamine-conjugated anti-rat IgG. Note the punctate staining of HA fluorescent signals that correspond to ER in apo(a)-expressing cells and the membrane staining of the cell–cell contact sites in E-cadherin (a cell–cell adhesion molecule)-expressing cells. Bar, 25 μm. C, Stably transfected pig kidney epithelial cells expressing human apo(a) were immunostained with anti-HA monoclonal antibody. Note the ER staining. Bar, 25 μm. D, Total cell lysates of parental pig kidney epithelial (PKE) cells or stable transfectants [apo(a)+] were subjected to immunoblot analysis with anti-HA antibody. E, Conditioned medium of PKE or apo(a)+ cells were subjected to immunoprecipitation with anti-HA antibody. Collected materials were subjected to immunoblot analysis with anti-apo(a) antibody.

Mentions: The plasmid vector used in this experiment, pC-apo(a)HA, is shown in Fig 1. Human apo(a) cDNA has been described [4]. To facilitate the detection of apo(a), apo(a) was tagged with hemagglutinin (HA) at the C-terminus by PCR using the primers ATCCCTCTCTGTGCATCCTCT and CGAATTATTTCTCATCATTCCCTCAA and apo(a) cDNA as a template. After generating blunt ends using T4 DNA polymerase, the PCR product was digested with the PvuI restriction enzyme and cloned into the EcoRV site of the pC-SnailHA vector [19]. Then, the EcoRI–KpnI fragment of apo(a) was cloned into the vector, yielding pC-apo(a)HA.


Production of Cloned Miniature Pigs Expressing High Levels of Human Apolipoprotein(a) in Plasma.

Ozawa M, Himaki T, Ookutsu S, Mizobe Y, Ogawa J, Miyoshi K, Yabuki A, Fan J, Yoshida M - PLoS ONE (2015)

Isolation of pig kidney epithelial cells stably expressing human apo(a).A, schematic representation of the pC-apo(a)HA construct. The vector contains the CAG promoter, HA-tagged apo(a) gene, β-globin polyadenylation signal (polyA), and neo gene under the control of herpes simplex virus thymidine kinase (tk) promoter. B, stable transfectants of MDCK cells expressing HA-tagged human apo(a) or HA-tagged E-cadherin (Ecad) were immunostained with anti-HA monoclonal antibody, followed by rhodamine-conjugated anti-rat IgG. Note the punctate staining of HA fluorescent signals that correspond to ER in apo(a)-expressing cells and the membrane staining of the cell–cell contact sites in E-cadherin (a cell–cell adhesion molecule)-expressing cells. Bar, 25 μm. C, Stably transfected pig kidney epithelial cells expressing human apo(a) were immunostained with anti-HA monoclonal antibody. Note the ER staining. Bar, 25 μm. D, Total cell lysates of parental pig kidney epithelial (PKE) cells or stable transfectants [apo(a)+] were subjected to immunoblot analysis with anti-HA antibody. E, Conditioned medium of PKE or apo(a)+ cells were subjected to immunoprecipitation with anti-HA antibody. Collected materials were subjected to immunoblot analysis with anti-apo(a) antibody.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4492603&req=5

pone.0132155.g001: Isolation of pig kidney epithelial cells stably expressing human apo(a).A, schematic representation of the pC-apo(a)HA construct. The vector contains the CAG promoter, HA-tagged apo(a) gene, β-globin polyadenylation signal (polyA), and neo gene under the control of herpes simplex virus thymidine kinase (tk) promoter. B, stable transfectants of MDCK cells expressing HA-tagged human apo(a) or HA-tagged E-cadherin (Ecad) were immunostained with anti-HA monoclonal antibody, followed by rhodamine-conjugated anti-rat IgG. Note the punctate staining of HA fluorescent signals that correspond to ER in apo(a)-expressing cells and the membrane staining of the cell–cell contact sites in E-cadherin (a cell–cell adhesion molecule)-expressing cells. Bar, 25 μm. C, Stably transfected pig kidney epithelial cells expressing human apo(a) were immunostained with anti-HA monoclonal antibody. Note the ER staining. Bar, 25 μm. D, Total cell lysates of parental pig kidney epithelial (PKE) cells or stable transfectants [apo(a)+] were subjected to immunoblot analysis with anti-HA antibody. E, Conditioned medium of PKE or apo(a)+ cells were subjected to immunoprecipitation with anti-HA antibody. Collected materials were subjected to immunoblot analysis with anti-apo(a) antibody.
Mentions: The plasmid vector used in this experiment, pC-apo(a)HA, is shown in Fig 1. Human apo(a) cDNA has been described [4]. To facilitate the detection of apo(a), apo(a) was tagged with hemagglutinin (HA) at the C-terminus by PCR using the primers ATCCCTCTCTGTGCATCCTCT and CGAATTATTTCTCATCATTCCCTCAA and apo(a) cDNA as a template. After generating blunt ends using T4 DNA polymerase, the PCR product was digested with the PvuI restriction enzyme and cloned into the EcoRV site of the pC-SnailHA vector [19]. Then, the EcoRI–KpnI fragment of apo(a) was cloned into the vector, yielding pC-apo(a)HA.

Bottom Line: However, because apolipoprotein(a) [apo(a)], the unique component of Lp(a), is found only in primates and humans, the study of human Lp(a) has been hampered due to the lack of appropriate animal models.Immunohistochemical analysis of tissue sections and RT-PCR analysis of total RNA from organs of cloned piglet revealed that apo(a) is expressed in various tissues/organs including heart, liver, kidney, and intestine.More importantly, a transgenic line exhibited a high level (>400 mg/dL) of Lp(a) in plasma, and the transgenic apo(a) gene was transmitted to the offspring.

View Article: PubMed Central - PubMed

Affiliation: Department of Biochemistry and Molecular Biology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima, Japan.

ABSTRACT
High lipoprotein(a) [Lp(a)] levels are a major risk factor for the development of atherosclerosis. However, because apolipoprotein(a) [apo(a)], the unique component of Lp(a), is found only in primates and humans, the study of human Lp(a) has been hampered due to the lack of appropriate animal models. Using somatic cell nuclear transfer (SCNT) techniques, we produced transgenic miniature pigs expressing human apo(a) in the plasma. First, we placed the hemagglutinin (HA)-tagged cDNA of human apo(a) under the control of the β-actin promoter and cytomegalovirus enhancer, and then introduced this construct into kidney epithelial cells. Immunostaining of cells with anti-HA antibody allowed identification of cells stably expressing apo(a); one of the positive clones was used to provide donor cells for SCNT, yielding blastocysts that expressed apo(a). Immunohistochemical analysis of tissue sections and RT-PCR analysis of total RNA from organs of cloned piglet revealed that apo(a) is expressed in various tissues/organs including heart, liver, kidney, and intestine. More importantly, a transgenic line exhibited a high level (>400 mg/dL) of Lp(a) in plasma, and the transgenic apo(a) gene was transmitted to the offspring. Thus, we generated a human apo(a)-transgenic miniature pig that can be used as a model system to study advanced atherosclerosis related to human disease. The anatomical and physiological similarities between the swine and human cardiovascular systems will make this pig model a valuable source of information on the role of apo(a) in the formation of atherosclerosis, as well as the mechanisms underlying vascular health and disease.

No MeSH data available.


Related in: MedlinePlus