Limits...
Investigation of a Large Collection of Pseudomonas aeruginosa Bacteriophages Collected from a Single Environmental Source in Abidjan, Côte d'Ivoire.

Essoh C, Latino L, Midoux C, Blouin Y, Loukou G, Nguetta SP, Lathro S, Cablanmian A, Kouassi AK, Vergnaud G, Pourcel C - PLoS ONE (2015)

Bottom Line: The vast majority of the genetic variations among virulent phages from the same genus resulted from seemingly non-random horizontal transfer events, inside a population of P. aeruginosa phages with limited diversity.This is the first study of P. aeruginosa phage diversity in an African city and it shows that a large variety of phage species can be recovered in a limited geographical site at least when different bacterial strains are used.The relative temporal and spatial stability of the Abidjan phage population might reflect equilibrium in the microbial community from which they are released.

View Article: PubMed Central - PubMed

Affiliation: Institute for Integrative Biology of the Cell, CEA, CNRS, Univ Paris-Sud, Université Paris-Saclay, Orsay, France.

ABSTRACT
Twenty two distinct bacteriophages were isolated from sewage water from five locations in the city of Abidjan, Côte d'Ivoire over a two-year period, using a collection of Pseudomonas aeruginosa strains with diverse genotypes. The phages were characterized by their virulence spectrum on a panel of selected P. aeruginosa strains from cystic fibrosis patients and by whole genome sequencing. Twelve virions representing the observed diversity were visualised by electron microscopy. The combined observations showed that 17 phages, distributed into seven genera, were virulent, and that five phages were related to temperate phages belonging to three genera. Some showed similarity with known phages only at the protein level. The vast majority of the genetic variations among virulent phages from the same genus resulted from seemingly non-random horizontal transfer events, inside a population of P. aeruginosa phages with limited diversity. This suggests the existence of a single environmental reservoir or ecotype in which continuous selection is taking place. In contrast, mostly point mutations were observed among phages potentially capable of lysogenisation. This is the first study of P. aeruginosa phage diversity in an African city and it shows that a large variety of phage species can be recovered in a limited geographical site at least when different bacterial strains are used. The relative temporal and spatial stability of the Abidjan phage population might reflect equilibrium in the microbial community from which they are released.

No MeSH data available.


Related in: MedlinePlus

Genomic organization of PB1-like phage Ab27.The different ORFs are colored according to their putative function: yellow, unknown; red nucleotide metabolism; orange, terminase; green, morphogenesis; blue, DNA replication; purple, lysis.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4482731&req=5

pone.0130548.g005: Genomic organization of PB1-like phage Ab27.The different ORFs are colored according to their putative function: yellow, unknown; red nucleotide metabolism; orange, terminase; green, morphogenesis; blue, DNA replication; purple, lysis.

Mentions: Three phages (Ab27, Ab28 and Ab29) presented on average a 97% similarity level with several PB1-like virulent phages such as JG024 from Germany (66,275bp) [47], KPP12 from Japan (64,144bp) [48], NH-4 from Ireland (66,116 bp) [49], and SN from Russia (66,390bp) [50]. The presence of a category of reads with a single fixed termination tentatively marked the position of the phages genome ends, but there was no indication of a DTR. Based on this information, the first nucleotide could be positioned about 7,500bp upstream that reported for phage PB1. Alignment of the three phage genomes showed that Ab27 and Ab29 were quite similar, except for the first 4,400bp and the last 11,400bp where traces of recombination events could be seen (S5 Fig), characterized by a high density of nucleotides variations. Ab28 was very different from the other two at the nucleotide level, but the ORFs were remarkably well conserved in the three phages, and other PB1-like phages. The genome organization of phage Ab27 is shown on Fig 5. There was no RNA polymerase, but there seemed to be a complete DNA replication machinery as observed in other PB1-like phages. Between Ab27 ORF60 and ORF61 (position 36,360), reads contained either 9 or 10 G suggesting a possibility of phase variation at this site. Interestingly a 30 bp sequence (GATGCCCCGGCGAACCGGGGCGGGGTGGTT) at position 8,087–8,187 of the phage genome was present as a spacer in the Clustered Regularly Interspaced Region (CRISPR) of several P. aeruginosa genomes. This structure is part of an adaptive immune system believed to play a role in P. aeruginosa resistance to bacteriophages and plasmids [51], but is usually not associated with resistance to lytic phages. Several studies have shown that in P. aeruginosa, CRISPRs carry mostly sequences of temperate phages [26,51]. Our observation suggests that the CRISPR-Cas system may play a role in regulation of PB1-like phages infection.


Investigation of a Large Collection of Pseudomonas aeruginosa Bacteriophages Collected from a Single Environmental Source in Abidjan, Côte d'Ivoire.

Essoh C, Latino L, Midoux C, Blouin Y, Loukou G, Nguetta SP, Lathro S, Cablanmian A, Kouassi AK, Vergnaud G, Pourcel C - PLoS ONE (2015)

Genomic organization of PB1-like phage Ab27.The different ORFs are colored according to their putative function: yellow, unknown; red nucleotide metabolism; orange, terminase; green, morphogenesis; blue, DNA replication; purple, lysis.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4482731&req=5

pone.0130548.g005: Genomic organization of PB1-like phage Ab27.The different ORFs are colored according to their putative function: yellow, unknown; red nucleotide metabolism; orange, terminase; green, morphogenesis; blue, DNA replication; purple, lysis.
Mentions: Three phages (Ab27, Ab28 and Ab29) presented on average a 97% similarity level with several PB1-like virulent phages such as JG024 from Germany (66,275bp) [47], KPP12 from Japan (64,144bp) [48], NH-4 from Ireland (66,116 bp) [49], and SN from Russia (66,390bp) [50]. The presence of a category of reads with a single fixed termination tentatively marked the position of the phages genome ends, but there was no indication of a DTR. Based on this information, the first nucleotide could be positioned about 7,500bp upstream that reported for phage PB1. Alignment of the three phage genomes showed that Ab27 and Ab29 were quite similar, except for the first 4,400bp and the last 11,400bp where traces of recombination events could be seen (S5 Fig), characterized by a high density of nucleotides variations. Ab28 was very different from the other two at the nucleotide level, but the ORFs were remarkably well conserved in the three phages, and other PB1-like phages. The genome organization of phage Ab27 is shown on Fig 5. There was no RNA polymerase, but there seemed to be a complete DNA replication machinery as observed in other PB1-like phages. Between Ab27 ORF60 and ORF61 (position 36,360), reads contained either 9 or 10 G suggesting a possibility of phase variation at this site. Interestingly a 30 bp sequence (GATGCCCCGGCGAACCGGGGCGGGGTGGTT) at position 8,087–8,187 of the phage genome was present as a spacer in the Clustered Regularly Interspaced Region (CRISPR) of several P. aeruginosa genomes. This structure is part of an adaptive immune system believed to play a role in P. aeruginosa resistance to bacteriophages and plasmids [51], but is usually not associated with resistance to lytic phages. Several studies have shown that in P. aeruginosa, CRISPRs carry mostly sequences of temperate phages [26,51]. Our observation suggests that the CRISPR-Cas system may play a role in regulation of PB1-like phages infection.

Bottom Line: The vast majority of the genetic variations among virulent phages from the same genus resulted from seemingly non-random horizontal transfer events, inside a population of P. aeruginosa phages with limited diversity.This is the first study of P. aeruginosa phage diversity in an African city and it shows that a large variety of phage species can be recovered in a limited geographical site at least when different bacterial strains are used.The relative temporal and spatial stability of the Abidjan phage population might reflect equilibrium in the microbial community from which they are released.

View Article: PubMed Central - PubMed

Affiliation: Institute for Integrative Biology of the Cell, CEA, CNRS, Univ Paris-Sud, Université Paris-Saclay, Orsay, France.

ABSTRACT
Twenty two distinct bacteriophages were isolated from sewage water from five locations in the city of Abidjan, Côte d'Ivoire over a two-year period, using a collection of Pseudomonas aeruginosa strains with diverse genotypes. The phages were characterized by their virulence spectrum on a panel of selected P. aeruginosa strains from cystic fibrosis patients and by whole genome sequencing. Twelve virions representing the observed diversity were visualised by electron microscopy. The combined observations showed that 17 phages, distributed into seven genera, were virulent, and that five phages were related to temperate phages belonging to three genera. Some showed similarity with known phages only at the protein level. The vast majority of the genetic variations among virulent phages from the same genus resulted from seemingly non-random horizontal transfer events, inside a population of P. aeruginosa phages with limited diversity. This suggests the existence of a single environmental reservoir or ecotype in which continuous selection is taking place. In contrast, mostly point mutations were observed among phages potentially capable of lysogenisation. This is the first study of P. aeruginosa phage diversity in an African city and it shows that a large variety of phage species can be recovered in a limited geographical site at least when different bacterial strains are used. The relative temporal and spatial stability of the Abidjan phage population might reflect equilibrium in the microbial community from which they are released.

No MeSH data available.


Related in: MedlinePlus