Limits...
Analysis of pollen-specific alternative splicing in Arabidopsis thaliana via semi-quantitative PCR.

Estrada AD, Freese NH, Blakley IC, Loraine AE - PeerJ (2015)

Bottom Line: PCR testing confirmed eight of nine alternative splicing patterns, and results from the ninth were inconclusive.In four genes, alternative transcriptional start sites coincided with alternative splicing.This study highlights the value of the low-cost PCR assay as a method of validating RNA-Seq results.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Bioinformatics and Genomics, North Carolina Research Campus, University of North Carolina at Charlotte , Charlotte, NC , USA.

ABSTRACT
Alternative splicing enables a single gene to produce multiple mRNA isoforms by varying splice site selection. In animals, alternative splicing of mRNA isoforms between cell types is widespread and supports cellular differentiation. In plants, at least 20% of multi-exon genes are alternatively spliced, but the extent and significance of tissue-specific splicing is less well understood, partly because it is difficult to isolate cells of a single type. Pollen is a useful model system to study tissue-specific splicing in higher plants because pollen grains contain only two cell types and can be collected in large amounts without damaging cells. Previously, we identified pollen-specific splicing patterns by comparing RNA-Seq data from Arabidopsis pollen and leaves. Here, we used semi-quantitative PCR to validate pollen-specific splicing patterns among genes where RNA-Seq data analysis indicated splicing was most different between pollen and leaves. PCR testing confirmed eight of nine alternative splicing patterns, and results from the ninth were inconclusive. In four genes, alternative transcriptional start sites coincided with alternative splicing. This study highlights the value of the low-cost PCR assay as a method of validating RNA-Seq results.

No MeSH data available.


Pollen-specific splicing in At-SR30.(A) Junction features from RNA-Seq reads for leaf (L1, L2) and pollen (P3) samples alongside annotated gene models. Numbers indicate how many spliced reads supported the indicated junction in pollen and leaf RNA-Seq libraries. Arrows indicate the direction of transcription and taller blocks show translated regions. Primers used in semi-quantitative PCR are shown. Primer sequences were CCAGTGGCCAGTTTTCATTT (F) and GTGTGAGTCGAAGCCCAGAT (R). (B) Gel electrophoresis of PCR amplification of pollen (P1, P2, P3) and leaf (L3, L4) cDNAs and corresponding model of alternative splice variants. Estimated fragment size from gel and theoretical fragment size based on splice model found to left and right, respectively, in base pairs (bp). (C) Percent total of each observed splice variant in pollen and leaf samples quantified from gel electrophoresis in (B). Values are averages of replicate samples. Error bars indicate two standard deviations. Asterisk indicates p-value less than 0.05, double asterisk less than 0.01.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4419537&req=5

fig-1: Pollen-specific splicing in At-SR30.(A) Junction features from RNA-Seq reads for leaf (L1, L2) and pollen (P3) samples alongside annotated gene models. Numbers indicate how many spliced reads supported the indicated junction in pollen and leaf RNA-Seq libraries. Arrows indicate the direction of transcription and taller blocks show translated regions. Primers used in semi-quantitative PCR are shown. Primer sequences were CCAGTGGCCAGTTTTCATTT (F) and GTGTGAGTCGAAGCCCAGAT (R). (B) Gel electrophoresis of PCR amplification of pollen (P1, P2, P3) and leaf (L3, L4) cDNAs and corresponding model of alternative splice variants. Estimated fragment size from gel and theoretical fragment size based on splice model found to left and right, respectively, in base pairs (bp). (C) Percent total of each observed splice variant in pollen and leaf samples quantified from gel electrophoresis in (B). Values are averages of replicate samples. Error bars indicate two standard deviations. Asterisk indicates p-value less than 0.05, double asterisk less than 0.01.

Mentions: At-SR30 and At-RS41 encode two of eighteen serine/arginine-rich (SR) RNA-binding proteins in Arabidopsis (Barta, Kalyna & Reddy, 2010) thought to play a role in regulation of splice site choice. According to the RNA-Seq data, At-SR30 (Fig. 1A) and At-RS41 (Fig. 2A) were differentially spliced in pollen and leaf. Figures 1A and 2A show junction features aligned onto each gene, where features summarize the number of spliced reads in each sample that supported the corresponding intron in the gene models. In both genes, the relative abundance of spliced reads supporting alternative splicing events was clearly different in leaf versus pollen. We also observed a small number of unspliced reads that aligned to the differentially spliced intron, indicating a low level of intron retention (not shown), a common form of alternative splicing in plants (English, Patel & Loraine, 2010).


Analysis of pollen-specific alternative splicing in Arabidopsis thaliana via semi-quantitative PCR.

Estrada AD, Freese NH, Blakley IC, Loraine AE - PeerJ (2015)

Pollen-specific splicing in At-SR30.(A) Junction features from RNA-Seq reads for leaf (L1, L2) and pollen (P3) samples alongside annotated gene models. Numbers indicate how many spliced reads supported the indicated junction in pollen and leaf RNA-Seq libraries. Arrows indicate the direction of transcription and taller blocks show translated regions. Primers used in semi-quantitative PCR are shown. Primer sequences were CCAGTGGCCAGTTTTCATTT (F) and GTGTGAGTCGAAGCCCAGAT (R). (B) Gel electrophoresis of PCR amplification of pollen (P1, P2, P3) and leaf (L3, L4) cDNAs and corresponding model of alternative splice variants. Estimated fragment size from gel and theoretical fragment size based on splice model found to left and right, respectively, in base pairs (bp). (C) Percent total of each observed splice variant in pollen and leaf samples quantified from gel electrophoresis in (B). Values are averages of replicate samples. Error bars indicate two standard deviations. Asterisk indicates p-value less than 0.05, double asterisk less than 0.01.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4419537&req=5

fig-1: Pollen-specific splicing in At-SR30.(A) Junction features from RNA-Seq reads for leaf (L1, L2) and pollen (P3) samples alongside annotated gene models. Numbers indicate how many spliced reads supported the indicated junction in pollen and leaf RNA-Seq libraries. Arrows indicate the direction of transcription and taller blocks show translated regions. Primers used in semi-quantitative PCR are shown. Primer sequences were CCAGTGGCCAGTTTTCATTT (F) and GTGTGAGTCGAAGCCCAGAT (R). (B) Gel electrophoresis of PCR amplification of pollen (P1, P2, P3) and leaf (L3, L4) cDNAs and corresponding model of alternative splice variants. Estimated fragment size from gel and theoretical fragment size based on splice model found to left and right, respectively, in base pairs (bp). (C) Percent total of each observed splice variant in pollen and leaf samples quantified from gel electrophoresis in (B). Values are averages of replicate samples. Error bars indicate two standard deviations. Asterisk indicates p-value less than 0.05, double asterisk less than 0.01.
Mentions: At-SR30 and At-RS41 encode two of eighteen serine/arginine-rich (SR) RNA-binding proteins in Arabidopsis (Barta, Kalyna & Reddy, 2010) thought to play a role in regulation of splice site choice. According to the RNA-Seq data, At-SR30 (Fig. 1A) and At-RS41 (Fig. 2A) were differentially spliced in pollen and leaf. Figures 1A and 2A show junction features aligned onto each gene, where features summarize the number of spliced reads in each sample that supported the corresponding intron in the gene models. In both genes, the relative abundance of spliced reads supporting alternative splicing events was clearly different in leaf versus pollen. We also observed a small number of unspliced reads that aligned to the differentially spliced intron, indicating a low level of intron retention (not shown), a common form of alternative splicing in plants (English, Patel & Loraine, 2010).

Bottom Line: PCR testing confirmed eight of nine alternative splicing patterns, and results from the ninth were inconclusive.In four genes, alternative transcriptional start sites coincided with alternative splicing.This study highlights the value of the low-cost PCR assay as a method of validating RNA-Seq results.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Bioinformatics and Genomics, North Carolina Research Campus, University of North Carolina at Charlotte , Charlotte, NC , USA.

ABSTRACT
Alternative splicing enables a single gene to produce multiple mRNA isoforms by varying splice site selection. In animals, alternative splicing of mRNA isoforms between cell types is widespread and supports cellular differentiation. In plants, at least 20% of multi-exon genes are alternatively spliced, but the extent and significance of tissue-specific splicing is less well understood, partly because it is difficult to isolate cells of a single type. Pollen is a useful model system to study tissue-specific splicing in higher plants because pollen grains contain only two cell types and can be collected in large amounts without damaging cells. Previously, we identified pollen-specific splicing patterns by comparing RNA-Seq data from Arabidopsis pollen and leaves. Here, we used semi-quantitative PCR to validate pollen-specific splicing patterns among genes where RNA-Seq data analysis indicated splicing was most different between pollen and leaves. PCR testing confirmed eight of nine alternative splicing patterns, and results from the ninth were inconclusive. In four genes, alternative transcriptional start sites coincided with alternative splicing. This study highlights the value of the low-cost PCR assay as a method of validating RNA-Seq results.

No MeSH data available.