Limits...
Pain-related stress during the Neonatal Intensive Care Unit stay and SLC6A4 methylation in very preterm infants.

Provenzi L, Fumagalli M, Sirgiovanni I, Giorda R, Pozzoli U, Morandi F, Beri S, Menozzi G, Mosca F, Borgatti R, Montirosso R - Front Behav Neurosci (2015)

Bottom Line: Alterations of DNA methylation at the promoter region of the SLC6A4 have been associated with early adverse experiences in infants.In order to exclude the potential effect of birth status (i.e., preterm vs. full-term birth) on SLC6A4 methylation, we preliminarily assessed SLC6A4 epigenetic differences between VPT and full-term (FT) infants at birth.Methylation at CpG sites 5 and 6 significantly increased from birth to NICU discharge only for HPE VPT infants.

View Article: PubMed Central - PubMed

Affiliation: 0-3 Center for the Study of Social Emotional Development of the at-Risk Infant, Scientific Institute, IRCCS Eugenio Medea Bosisio Parini (LC), Italy.

ABSTRACT
Very preterm (VPT) infants need long-lasting hospitalization in the Neonatal Intensive Care Unit (NICU) during which they are daily exposed to pain-related stress. Alterations of DNA methylation at the promoter region of the SLC6A4 have been associated with early adverse experiences in infants. The main aim of the present work was to investigate the association between level of exposure to pain-related stress during hospitalization and changes in SLC6A4 DNA methylation at NICU discharge in VPT infants. In order to exclude the potential effect of birth status (i.e., preterm vs. full-term birth) on SLC6A4 methylation, we preliminarily assessed SLC6A4 epigenetic differences between VPT and full-term (FT) infants at birth. Fifty-six VPT and thirty-two FT infants participated in the study. The level of exposure to pain-related stress was quantified on the basis of the amount of skin-breaking procedures to which they were exposed. VPT infants were divided in two sub-groups: low-pain exposure (LPE, N = 25) and high-pain exposure (HPE, N = 31). DNA methylation was evaluated at birth for both VPT and FT infants, assessing 20 CpG sites within the SLC6A4 promoter region. The same CpG sites were re-evaluated for variations in DNA methylation at NICU discharge in LPE and HPE VPT infants. No differences in SLC6A4 CpG sites' methylation emerged between FT and VPT infants at birth. Methylation at CpG sites 5 and 6 significantly increased from birth to NICU discharge only for HPE VPT infants. Findings show that preterm birth per se is not associated with epigenetic alterations of the SLC6A4, whereas higher levels of pain-related stress exposure during NICU stay might alter the transcriptional functionality of the serotonin transporter gene.

No MeSH data available.


Related in: MedlinePlus

Schematic overview of the analyzed CpG sites in the SLC6A4 gene promoter region. CpG sites are underlined. PCR primer sequences are boxed. Analyzed CpG sites are indicated by numbers 1–20.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4403508&req=5

Figure 1: Schematic overview of the analyzed CpG sites in the SLC6A4 gene promoter region. CpG sites are underlined. PCR primer sequences are boxed. Analyzed CpG sites are indicated by numbers 1–20.

Mentions: We analyzed a CpG-rich region of the SLC6A4 promoter (chr17:28562750-28562958, Human hg19 Assembly; see Figure 1), between −69 and −213 relative to the transcriptional start site, which contains 20 CpG sites and is adjacent to exon 1a. The region of SLC6A4 we analyzed has been recognized to be associated with variations in SLC6A4 mRNA expression (Philibert et al., 2007) and has been previously shown to be differentially methylated in threat-related amygdala reactivity (Nikolova et al., 2014). It contains multiple DNase-hypersensitivity sites (Sabo et al., 2006), a universal feature of active cis-regulatory sequences, and shows the highest degree of evolutionary conservation between 100 vertebrates, measured using phyloP (Siepel et al., 2005) in the 5′-end of the gene. Methylation levels were determined in DNA from cord blood or peripheral blood using bisulfite modification followed by NGS. Genomic DNA was extracted from 0.2 ml of each sample using the GenElute Blood Genomic DNA kit (Sigma). Bisulfite conversion was performed on 500 ng of genomic DNA using the EZ DNA methylation kit (ZymoResearch, Inc, Irvine, CA, USA). Primers were designed using Bisulfite Primer Seeker (http://www.zymoresearch.com/tools/bisulfite-primer-seeker). The gene-specific forward 5′-GYGGGTTTTTATATGGTTTGATTTTTAG-3′ and reverse 5′-CRAAAATCCCTCCCCTCCTAACTCTAAAATC-3′ primers correspond to the boxed sequences in Figure 1. A TruSeq amplicon-specific tail 5′ CCTACACGACGCTCTTCCGATCT 3′ was added to the forward primer, while the sequence 5′ TCAGACGTGTGCTCAACCGATCT 3′ was added to the reverse primer, in order to allow synthesis and sequencing of TruSeq libraries of methylated fragments. Primary PCR amplifications were performed on 20 ng of bisulfite-treated DNA using Taq Gold (Life Technologies, Inc.). Cycling consisted of 5 min pre-activation at 95°C, followed by 35 cycles of 94°C denaturation for 15 s, 58°C annealing for 20 s, 72°C elongation for 1 min 30 s. All PCR products were checked on 2% agarose TAE gels, then treated with Ilustra Exo Pro-STAR (GE Healthcare) to eliminate unincorporated primers. Secondary PCR was conducted on each sample using a TruSeq Custom Amplicon Index Kit (Illumina) containing eight forward (i5) and twelve reverse (i7) index primers allowing unique tagging of 96 samples. Optimal annealing temperature (68°C) and number of PCR cycles (16) were experimentally determined. Cycling consisted of 5 min pre-activation at 95°C, followed by 16 cycles of 94°C denaturation for 15 s, 68°C annealing for 20 s, 72°C elongation for 1 min. Again all PCR products were checked on 2% agarose TAE gels, then approximately equimolar aliquots of each product were pooled and purified on a 2% agarose TAE gel. The purified library was quantified on a Bioanalyzer 2100 (Agilent) and sequenced on a MiSeq (Illumina) using a v2 Reagent kit, 300 cycles PE. Paired ends reads from each sample were independently aligned to all the reference sequences by a parallel striped Smith-Waterman algorithm. Only paired reads that aligned coherently to the same reference sequence were retained. At each CpG site in each sequence, the 4 base frequencies were evaluated and reported along with the C→T percentage.


Pain-related stress during the Neonatal Intensive Care Unit stay and SLC6A4 methylation in very preterm infants.

Provenzi L, Fumagalli M, Sirgiovanni I, Giorda R, Pozzoli U, Morandi F, Beri S, Menozzi G, Mosca F, Borgatti R, Montirosso R - Front Behav Neurosci (2015)

Schematic overview of the analyzed CpG sites in the SLC6A4 gene promoter region. CpG sites are underlined. PCR primer sequences are boxed. Analyzed CpG sites are indicated by numbers 1–20.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4403508&req=5

Figure 1: Schematic overview of the analyzed CpG sites in the SLC6A4 gene promoter region. CpG sites are underlined. PCR primer sequences are boxed. Analyzed CpG sites are indicated by numbers 1–20.
Mentions: We analyzed a CpG-rich region of the SLC6A4 promoter (chr17:28562750-28562958, Human hg19 Assembly; see Figure 1), between −69 and −213 relative to the transcriptional start site, which contains 20 CpG sites and is adjacent to exon 1a. The region of SLC6A4 we analyzed has been recognized to be associated with variations in SLC6A4 mRNA expression (Philibert et al., 2007) and has been previously shown to be differentially methylated in threat-related amygdala reactivity (Nikolova et al., 2014). It contains multiple DNase-hypersensitivity sites (Sabo et al., 2006), a universal feature of active cis-regulatory sequences, and shows the highest degree of evolutionary conservation between 100 vertebrates, measured using phyloP (Siepel et al., 2005) in the 5′-end of the gene. Methylation levels were determined in DNA from cord blood or peripheral blood using bisulfite modification followed by NGS. Genomic DNA was extracted from 0.2 ml of each sample using the GenElute Blood Genomic DNA kit (Sigma). Bisulfite conversion was performed on 500 ng of genomic DNA using the EZ DNA methylation kit (ZymoResearch, Inc, Irvine, CA, USA). Primers were designed using Bisulfite Primer Seeker (http://www.zymoresearch.com/tools/bisulfite-primer-seeker). The gene-specific forward 5′-GYGGGTTTTTATATGGTTTGATTTTTAG-3′ and reverse 5′-CRAAAATCCCTCCCCTCCTAACTCTAAAATC-3′ primers correspond to the boxed sequences in Figure 1. A TruSeq amplicon-specific tail 5′ CCTACACGACGCTCTTCCGATCT 3′ was added to the forward primer, while the sequence 5′ TCAGACGTGTGCTCAACCGATCT 3′ was added to the reverse primer, in order to allow synthesis and sequencing of TruSeq libraries of methylated fragments. Primary PCR amplifications were performed on 20 ng of bisulfite-treated DNA using Taq Gold (Life Technologies, Inc.). Cycling consisted of 5 min pre-activation at 95°C, followed by 35 cycles of 94°C denaturation for 15 s, 58°C annealing for 20 s, 72°C elongation for 1 min 30 s. All PCR products were checked on 2% agarose TAE gels, then treated with Ilustra Exo Pro-STAR (GE Healthcare) to eliminate unincorporated primers. Secondary PCR was conducted on each sample using a TruSeq Custom Amplicon Index Kit (Illumina) containing eight forward (i5) and twelve reverse (i7) index primers allowing unique tagging of 96 samples. Optimal annealing temperature (68°C) and number of PCR cycles (16) were experimentally determined. Cycling consisted of 5 min pre-activation at 95°C, followed by 16 cycles of 94°C denaturation for 15 s, 68°C annealing for 20 s, 72°C elongation for 1 min. Again all PCR products were checked on 2% agarose TAE gels, then approximately equimolar aliquots of each product were pooled and purified on a 2% agarose TAE gel. The purified library was quantified on a Bioanalyzer 2100 (Agilent) and sequenced on a MiSeq (Illumina) using a v2 Reagent kit, 300 cycles PE. Paired ends reads from each sample were independently aligned to all the reference sequences by a parallel striped Smith-Waterman algorithm. Only paired reads that aligned coherently to the same reference sequence were retained. At each CpG site in each sequence, the 4 base frequencies were evaluated and reported along with the C→T percentage.

Bottom Line: Alterations of DNA methylation at the promoter region of the SLC6A4 have been associated with early adverse experiences in infants.In order to exclude the potential effect of birth status (i.e., preterm vs. full-term birth) on SLC6A4 methylation, we preliminarily assessed SLC6A4 epigenetic differences between VPT and full-term (FT) infants at birth.Methylation at CpG sites 5 and 6 significantly increased from birth to NICU discharge only for HPE VPT infants.

View Article: PubMed Central - PubMed

Affiliation: 0-3 Center for the Study of Social Emotional Development of the at-Risk Infant, Scientific Institute, IRCCS Eugenio Medea Bosisio Parini (LC), Italy.

ABSTRACT
Very preterm (VPT) infants need long-lasting hospitalization in the Neonatal Intensive Care Unit (NICU) during which they are daily exposed to pain-related stress. Alterations of DNA methylation at the promoter region of the SLC6A4 have been associated with early adverse experiences in infants. The main aim of the present work was to investigate the association between level of exposure to pain-related stress during hospitalization and changes in SLC6A4 DNA methylation at NICU discharge in VPT infants. In order to exclude the potential effect of birth status (i.e., preterm vs. full-term birth) on SLC6A4 methylation, we preliminarily assessed SLC6A4 epigenetic differences between VPT and full-term (FT) infants at birth. Fifty-six VPT and thirty-two FT infants participated in the study. The level of exposure to pain-related stress was quantified on the basis of the amount of skin-breaking procedures to which they were exposed. VPT infants were divided in two sub-groups: low-pain exposure (LPE, N = 25) and high-pain exposure (HPE, N = 31). DNA methylation was evaluated at birth for both VPT and FT infants, assessing 20 CpG sites within the SLC6A4 promoter region. The same CpG sites were re-evaluated for variations in DNA methylation at NICU discharge in LPE and HPE VPT infants. No differences in SLC6A4 CpG sites' methylation emerged between FT and VPT infants at birth. Methylation at CpG sites 5 and 6 significantly increased from birth to NICU discharge only for HPE VPT infants. Findings show that preterm birth per se is not associated with epigenetic alterations of the SLC6A4, whereas higher levels of pain-related stress exposure during NICU stay might alter the transcriptional functionality of the serotonin transporter gene.

No MeSH data available.


Related in: MedlinePlus