Limits...
Single cell FRET analysis for the identification of optimal FRET-pairs in Bacillus subtilis using a prototype MEM-FLIM system.

Detert Oude Weme RG, Kovács ÁT, de Jong SJ, Veening JW, Siebring J, Kuipers OP - PLoS ONE (2015)

Bottom Line: Protein-protein interactions can be studied in vitro, e.g. with bacterial or yeast two-hybrid systems or surface plasmon resonance.In contrast to in vitro techniques, in vivo studies of protein-protein interactions allow examination of spatial and temporal behavior of such interactions in their native environment.This work will facilitate future studies of in vivo dynamics of protein complexes in single B. subtilis cells.

View Article: PubMed Central - PubMed

Affiliation: Molecular Genetics Group, Groningen Biomolecular Sciences and Biotechnology Institute, Centre for Synthetic Biology, University of Groningen, 9747 AG Groningen, The Netherlands.

ABSTRACT
Protein-protein interactions can be studied in vitro, e.g. with bacterial or yeast two-hybrid systems or surface plasmon resonance. In contrast to in vitro techniques, in vivo studies of protein-protein interactions allow examination of spatial and temporal behavior of such interactions in their native environment. One approach to study protein-protein interactions in vivo is via Förster Resonance Energy Transfer (FRET). Here, FRET efficiency of selected FRET-pairs was studied at the single cell level using sensitized emission and Frequency Domain-Fluorescence Lifetime Imaging Microscopy (FD-FLIM). For FRET-FLIM, a prototype Modulated Electron-Multiplied FLIM system was used, which is, to the best of our knowledge, the first account of Frequency Domain FLIM to analyze FRET in single bacterial cells. To perform FRET-FLIM, we first determined and benchmarked the best fluorescent protein-pair for FRET in Bacillus subtilis using a novel BglBrick-compatible integration vector. We show that GFP-tagRFP is an excellent donor-acceptor pair for B. subtilis in vivo FRET studies. As a proof of concept, selected donor and acceptor fluorescent proteins were fused using a linker that contained a tobacco etch virus (TEV)-protease recognition sequence. Induction of TEV-protease results in loss of FRET efficiency and increase in fluorescence lifetime. The loss of FRET efficiency after TEV induction can be followed in time in single cells via time-lapse microscopy. This work will facilitate future studies of in vivo dynamics of protein complexes in single B. subtilis cells.

Show MeSH

Related in: MedlinePlus

Map of the amyE integration vector pDOW01 with BglBrick cloning site, EcoRI, BglII, BamHI and XhoI indicated in italics.Indicated in bold are the RBS (AGGAGG), the TEV-protease recognition site (GAGAATTTGTATTTTCAGGGT; amino acid sequence ENLYFQG) and the two stopcodons (TAATAA).
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4401445&req=5

pone.0123239.g001: Map of the amyE integration vector pDOW01 with BglBrick cloning site, EcoRI, BglII, BamHI and XhoI indicated in italics.Indicated in bold are the RBS (AGGAGG), the TEV-protease recognition site (GAGAATTTGTATTTTCAGGGT; amino acid sequence ENLYFQG) and the two stopcodons (TAATAA).

Mentions: The homologous regions of the amyE gene and the spectinomycin marker from pDR111 (from 115–4707) and the E. coli origin of replication (1888–2583) from the pUC18 vector were PCR amplified including the NcoI and SpeI restriction sites in the primer sequences to combine the fragments into a pDR-pUC-hybrid (see Table 3 for the primers). Subsequently, Quikchange PCR (Agilent) was used to remove the BamHI site at position 745, with primers pDR111_quikchange_FW and pDR111_quikchange_REV. The part between 2100–2528 bp in the original pDR111 vector was redesigned in silico and ordered from Mr. Gene (Regensburg, Germany), with the following changes. The XhoI, BglII and EcoRI sites were removed by point mutation. The SalI site was removed and in the upstream direction a RBS with a seven bp spacer to the start codon was inserted. The start codon was followed by the BglBrick prefix, the TEV-protease recognition site, the BglBrick suffix, two stop codons, and a strong terminator sequence. The IPTG-inducible Phyper-spank promoter from pDR111 remained unchanged. The synthetic DNA was inserted into the pDR-pUC-hybrid by replacing the original 422 bp between the SphI- and PstI-sites with the 529 bp synthetic DNA via restriction and ligation. This final cloning step resulted in our basic cloning vector, pDOW01 (Fig 1). The newly constructed plasmid was fully re-sequenced and the plasmid sequence has been submitted to the Genbank database under accession number KM009065.


Single cell FRET analysis for the identification of optimal FRET-pairs in Bacillus subtilis using a prototype MEM-FLIM system.

Detert Oude Weme RG, Kovács ÁT, de Jong SJ, Veening JW, Siebring J, Kuipers OP - PLoS ONE (2015)

Map of the amyE integration vector pDOW01 with BglBrick cloning site, EcoRI, BglII, BamHI and XhoI indicated in italics.Indicated in bold are the RBS (AGGAGG), the TEV-protease recognition site (GAGAATTTGTATTTTCAGGGT; amino acid sequence ENLYFQG) and the two stopcodons (TAATAA).
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4401445&req=5

pone.0123239.g001: Map of the amyE integration vector pDOW01 with BglBrick cloning site, EcoRI, BglII, BamHI and XhoI indicated in italics.Indicated in bold are the RBS (AGGAGG), the TEV-protease recognition site (GAGAATTTGTATTTTCAGGGT; amino acid sequence ENLYFQG) and the two stopcodons (TAATAA).
Mentions: The homologous regions of the amyE gene and the spectinomycin marker from pDR111 (from 115–4707) and the E. coli origin of replication (1888–2583) from the pUC18 vector were PCR amplified including the NcoI and SpeI restriction sites in the primer sequences to combine the fragments into a pDR-pUC-hybrid (see Table 3 for the primers). Subsequently, Quikchange PCR (Agilent) was used to remove the BamHI site at position 745, with primers pDR111_quikchange_FW and pDR111_quikchange_REV. The part between 2100–2528 bp in the original pDR111 vector was redesigned in silico and ordered from Mr. Gene (Regensburg, Germany), with the following changes. The XhoI, BglII and EcoRI sites were removed by point mutation. The SalI site was removed and in the upstream direction a RBS with a seven bp spacer to the start codon was inserted. The start codon was followed by the BglBrick prefix, the TEV-protease recognition site, the BglBrick suffix, two stop codons, and a strong terminator sequence. The IPTG-inducible Phyper-spank promoter from pDR111 remained unchanged. The synthetic DNA was inserted into the pDR-pUC-hybrid by replacing the original 422 bp between the SphI- and PstI-sites with the 529 bp synthetic DNA via restriction and ligation. This final cloning step resulted in our basic cloning vector, pDOW01 (Fig 1). The newly constructed plasmid was fully re-sequenced and the plasmid sequence has been submitted to the Genbank database under accession number KM009065.

Bottom Line: Protein-protein interactions can be studied in vitro, e.g. with bacterial or yeast two-hybrid systems or surface plasmon resonance.In contrast to in vitro techniques, in vivo studies of protein-protein interactions allow examination of spatial and temporal behavior of such interactions in their native environment.This work will facilitate future studies of in vivo dynamics of protein complexes in single B. subtilis cells.

View Article: PubMed Central - PubMed

Affiliation: Molecular Genetics Group, Groningen Biomolecular Sciences and Biotechnology Institute, Centre for Synthetic Biology, University of Groningen, 9747 AG Groningen, The Netherlands.

ABSTRACT
Protein-protein interactions can be studied in vitro, e.g. with bacterial or yeast two-hybrid systems or surface plasmon resonance. In contrast to in vitro techniques, in vivo studies of protein-protein interactions allow examination of spatial and temporal behavior of such interactions in their native environment. One approach to study protein-protein interactions in vivo is via Förster Resonance Energy Transfer (FRET). Here, FRET efficiency of selected FRET-pairs was studied at the single cell level using sensitized emission and Frequency Domain-Fluorescence Lifetime Imaging Microscopy (FD-FLIM). For FRET-FLIM, a prototype Modulated Electron-Multiplied FLIM system was used, which is, to the best of our knowledge, the first account of Frequency Domain FLIM to analyze FRET in single bacterial cells. To perform FRET-FLIM, we first determined and benchmarked the best fluorescent protein-pair for FRET in Bacillus subtilis using a novel BglBrick-compatible integration vector. We show that GFP-tagRFP is an excellent donor-acceptor pair for B. subtilis in vivo FRET studies. As a proof of concept, selected donor and acceptor fluorescent proteins were fused using a linker that contained a tobacco etch virus (TEV)-protease recognition sequence. Induction of TEV-protease results in loss of FRET efficiency and increase in fluorescence lifetime. The loss of FRET efficiency after TEV induction can be followed in time in single cells via time-lapse microscopy. This work will facilitate future studies of in vivo dynamics of protein complexes in single B. subtilis cells.

Show MeSH
Related in: MedlinePlus