Limits...
The histone H3K9 demethylase Kdm3b is required for somatic growth and female reproductive function.

Liu Z, Chen X, Zhou S, Liao L, Jiang R, Xu J - Int. J. Biol. Sci. (2015)

Bottom Line: We found that Kdm3b ablation decreased IGFBP-3 expressed in the kidney by 53% and significantly reduced IGFBP-3 in the blood, which caused an accelerated degradation of IGF-1 and a 36% decrease in circulating IGF-1 concentration.We also found Kdm3b was highly expressed in the female reproductive organs including ovary, oviduct and uterus.Importantly, these female reproductive phenotypes were associated with significantly increased levels of H3K9me1/2/3 in the ovary and uterus.

View Article: PubMed Central - PubMed

Affiliation: 1. Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas, USA. ; 3. Institute of Cancer Prevention and Treatment, Harbin Medical University, Harbin, China.

ABSTRACT
Kdm3b is a Jumonji C domain-containing protein that demethylates mono- and di-methylated lysine 9 of histone H3 (H3K9me1 and H3K9me2). Although the enzyme activity of Kdm3b is well characterized in vitro, its genetic and physiological function remains unknown. Herein, we generated Kdm3b knockout (Kdm3bKO) mice and observed restricted postnatal growth and female infertility in these mice. We found that Kdm3b ablation decreased IGFBP-3 expressed in the kidney by 53% and significantly reduced IGFBP-3 in the blood, which caused an accelerated degradation of IGF-1 and a 36% decrease in circulating IGF-1 concentration. We also found Kdm3b was highly expressed in the female reproductive organs including ovary, oviduct and uterus. Knockout of Kdm3b in female mice caused irregular estrous cycles, decreased 45% of the ovulation capability and 47% of the fertilization rate, and reduced 44% of the uterine decidual response, which were accompanied with a more than 50% decrease in the circulating levels of the 17beta-estradiol. Importantly, these female reproductive phenotypes were associated with significantly increased levels of H3K9me1/2/3 in the ovary and uterus. These results demonstrate that Kdm3b-mediated H3K9 demethylation plays essential roles in maintenance of the circulating IGF-1, postnatal somatic growth, circulating 17beta-estradiol, and female reproductive function.

Show MeSH

Related in: MedlinePlus

Generation of Kdm3b knockout mice. (A). The gene targeting strategy. The Kdm3b genomic locus, targeting vector and targeted allele are sketched. The two black bars under the Kdm3b locus indicate the probes used in Southern blot analysis. The grey bars under the gene locus and the targeted allele indicate the DNA fragments amplified by PCR in genotype analysis. (B). Identification of correctly targeted ES clones by Southern blot. Representative results from a WT (+/+) clone and a heterozygously targeted (+/-) clone are presented. The 6.9 kb and 5.9 kb bands detected by the 5' probe and the 7.4 kb and 6.1 kb bands detected by the 3' probe represent the WT and the targeted alleles as indicated. (C). PCR-based genotype analysis of WT (+/+), heterozygous (+/-) and knockout (-/-) Kdm3b mice. The upper 300 bp and the lower 179 bp DNA fragments were amplified by PCR using allele-specific primer pairs from the knockout and the WT alleles, respectively. (D). Western blot analysis of Kdm3b protein in the liver lysates of WT (+/+) and Kdm3bKO (-/-) mice. Beta-actin serves as a loading control.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC4400382&req=5

Figure 1: Generation of Kdm3b knockout mice. (A). The gene targeting strategy. The Kdm3b genomic locus, targeting vector and targeted allele are sketched. The two black bars under the Kdm3b locus indicate the probes used in Southern blot analysis. The grey bars under the gene locus and the targeted allele indicate the DNA fragments amplified by PCR in genotype analysis. (B). Identification of correctly targeted ES clones by Southern blot. Representative results from a WT (+/+) clone and a heterozygously targeted (+/-) clone are presented. The 6.9 kb and 5.9 kb bands detected by the 5' probe and the 7.4 kb and 6.1 kb bands detected by the 3' probe represent the WT and the targeted alleles as indicated. (C). PCR-based genotype analysis of WT (+/+), heterozygous (+/-) and knockout (-/-) Kdm3b mice. The upper 300 bp and the lower 179 bp DNA fragments were amplified by PCR using allele-specific primer pairs from the knockout and the WT alleles, respectively. (D). Western blot analysis of Kdm3b protein in the liver lysates of WT (+/+) and Kdm3bKO (-/-) mice. Beta-actin serves as a loading control.

Mentions: The 5' and 3' homologous arms of the targeting vector were amplified from the genomic DNA extracted from TC-1 mouse ES cells 17 by PCR using the LA PCR kit (Takara Bio, Otsu, Shiga, Japan) and two pairs of primers, 5F (cggttaattaatggccaagatcaaaagatgga) paired with and 5R (aatgcggccgcgtggttctcaggcccattta) and 3F (aatctcgagaaaggactccgggaaactgt) paired with 3R (aaaggatcctagggccacacaggttaagg). The yielded DNA fragments were validated by sequencing and cloned into the pFRT-LoxP targeting vector 18 (Fig. 1A). The targeting vector was linearized and electroporated into TC-1 ES cells with a 129SvEv/j strain background. These ES cells were cultured in the selection medium and surviving clones were isolated and screened by Southern blot (Fig. 1A). The targeted ES cell clones were injected into the morulae collected from C57BL/6 female mice. The generated male chimeric founders were used to mate with C57BL/6 females to produce Kdm3b heterozygous (Kdm3b+/-) mice. Kdm3b+/- mice were further bred to produce WT, Kdm3b+/- and Kdm3b knockout (Kdm3b-/- or Dkm3bKO) mice. Mouse genomic DNA was prepared from a small piece of ear skin for genotype analysis as described previously 14. The WT Kdm3b allele was detected by PCR using Primer 22 (gaagagcaaagccagcctac) and Primer 23 (agagccaggagtgagacgtg). The targeted Kdm3b allele was detected by PCR using Primer KOV1 (gaaagtataggaacttcgtcgacctc) and Primer 28 (cacataaacaacactcaagtagcc). Animal protocols were approved by the Institutional Animal Care and Use Committee at Baylor College of Medicine.


The histone H3K9 demethylase Kdm3b is required for somatic growth and female reproductive function.

Liu Z, Chen X, Zhou S, Liao L, Jiang R, Xu J - Int. J. Biol. Sci. (2015)

Generation of Kdm3b knockout mice. (A). The gene targeting strategy. The Kdm3b genomic locus, targeting vector and targeted allele are sketched. The two black bars under the Kdm3b locus indicate the probes used in Southern blot analysis. The grey bars under the gene locus and the targeted allele indicate the DNA fragments amplified by PCR in genotype analysis. (B). Identification of correctly targeted ES clones by Southern blot. Representative results from a WT (+/+) clone and a heterozygously targeted (+/-) clone are presented. The 6.9 kb and 5.9 kb bands detected by the 5' probe and the 7.4 kb and 6.1 kb bands detected by the 3' probe represent the WT and the targeted alleles as indicated. (C). PCR-based genotype analysis of WT (+/+), heterozygous (+/-) and knockout (-/-) Kdm3b mice. The upper 300 bp and the lower 179 bp DNA fragments were amplified by PCR using allele-specific primer pairs from the knockout and the WT alleles, respectively. (D). Western blot analysis of Kdm3b protein in the liver lysates of WT (+/+) and Kdm3bKO (-/-) mice. Beta-actin serves as a loading control.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC4400382&req=5

Figure 1: Generation of Kdm3b knockout mice. (A). The gene targeting strategy. The Kdm3b genomic locus, targeting vector and targeted allele are sketched. The two black bars under the Kdm3b locus indicate the probes used in Southern blot analysis. The grey bars under the gene locus and the targeted allele indicate the DNA fragments amplified by PCR in genotype analysis. (B). Identification of correctly targeted ES clones by Southern blot. Representative results from a WT (+/+) clone and a heterozygously targeted (+/-) clone are presented. The 6.9 kb and 5.9 kb bands detected by the 5' probe and the 7.4 kb and 6.1 kb bands detected by the 3' probe represent the WT and the targeted alleles as indicated. (C). PCR-based genotype analysis of WT (+/+), heterozygous (+/-) and knockout (-/-) Kdm3b mice. The upper 300 bp and the lower 179 bp DNA fragments were amplified by PCR using allele-specific primer pairs from the knockout and the WT alleles, respectively. (D). Western blot analysis of Kdm3b protein in the liver lysates of WT (+/+) and Kdm3bKO (-/-) mice. Beta-actin serves as a loading control.
Mentions: The 5' and 3' homologous arms of the targeting vector were amplified from the genomic DNA extracted from TC-1 mouse ES cells 17 by PCR using the LA PCR kit (Takara Bio, Otsu, Shiga, Japan) and two pairs of primers, 5F (cggttaattaatggccaagatcaaaagatgga) paired with and 5R (aatgcggccgcgtggttctcaggcccattta) and 3F (aatctcgagaaaggactccgggaaactgt) paired with 3R (aaaggatcctagggccacacaggttaagg). The yielded DNA fragments were validated by sequencing and cloned into the pFRT-LoxP targeting vector 18 (Fig. 1A). The targeting vector was linearized and electroporated into TC-1 ES cells with a 129SvEv/j strain background. These ES cells were cultured in the selection medium and surviving clones were isolated and screened by Southern blot (Fig. 1A). The targeted ES cell clones were injected into the morulae collected from C57BL/6 female mice. The generated male chimeric founders were used to mate with C57BL/6 females to produce Kdm3b heterozygous (Kdm3b+/-) mice. Kdm3b+/- mice were further bred to produce WT, Kdm3b+/- and Kdm3b knockout (Kdm3b-/- or Dkm3bKO) mice. Mouse genomic DNA was prepared from a small piece of ear skin for genotype analysis as described previously 14. The WT Kdm3b allele was detected by PCR using Primer 22 (gaagagcaaagccagcctac) and Primer 23 (agagccaggagtgagacgtg). The targeted Kdm3b allele was detected by PCR using Primer KOV1 (gaaagtataggaacttcgtcgacctc) and Primer 28 (cacataaacaacactcaagtagcc). Animal protocols were approved by the Institutional Animal Care and Use Committee at Baylor College of Medicine.

Bottom Line: We found that Kdm3b ablation decreased IGFBP-3 expressed in the kidney by 53% and significantly reduced IGFBP-3 in the blood, which caused an accelerated degradation of IGF-1 and a 36% decrease in circulating IGF-1 concentration.We also found Kdm3b was highly expressed in the female reproductive organs including ovary, oviduct and uterus.Importantly, these female reproductive phenotypes were associated with significantly increased levels of H3K9me1/2/3 in the ovary and uterus.

View Article: PubMed Central - PubMed

Affiliation: 1. Department of Molecular and Cellular Biology, Baylor College of Medicine, Houston, Texas, USA. ; 3. Institute of Cancer Prevention and Treatment, Harbin Medical University, Harbin, China.

ABSTRACT
Kdm3b is a Jumonji C domain-containing protein that demethylates mono- and di-methylated lysine 9 of histone H3 (H3K9me1 and H3K9me2). Although the enzyme activity of Kdm3b is well characterized in vitro, its genetic and physiological function remains unknown. Herein, we generated Kdm3b knockout (Kdm3bKO) mice and observed restricted postnatal growth and female infertility in these mice. We found that Kdm3b ablation decreased IGFBP-3 expressed in the kidney by 53% and significantly reduced IGFBP-3 in the blood, which caused an accelerated degradation of IGF-1 and a 36% decrease in circulating IGF-1 concentration. We also found Kdm3b was highly expressed in the female reproductive organs including ovary, oviduct and uterus. Knockout of Kdm3b in female mice caused irregular estrous cycles, decreased 45% of the ovulation capability and 47% of the fertilization rate, and reduced 44% of the uterine decidual response, which were accompanied with a more than 50% decrease in the circulating levels of the 17beta-estradiol. Importantly, these female reproductive phenotypes were associated with significantly increased levels of H3K9me1/2/3 in the ovary and uterus. These results demonstrate that Kdm3b-mediated H3K9 demethylation plays essential roles in maintenance of the circulating IGF-1, postnatal somatic growth, circulating 17beta-estradiol, and female reproductive function.

Show MeSH
Related in: MedlinePlus