Limits...
Identification and Characterization of a Differentially Expressed Gene (07E12) in the Infective Larvae of the Parasitic Nematode Ascaris suum.

Huang C, You J, Nai F - Iran J Parasitol (2014 Apr-Jun)

Bottom Line: The results showed that the gene 07E12 was differentially expressed in the third-stage larvae of A. suum and its expression level in the infective larvae was much higher than in other stages.Likewise, by performing BLASTN and BLASTP searches in the GenBank™, it was shown that this gene had 99 % identity with A. suum cre-nlp-2 protein.This gene 07E12 which is differentially expressed in the third-stage larvae of A. suum may encode a neuropeptide-like protein family member, a very important molecule in the process of infecting a host.

View Article: PubMed Central - PubMed

Affiliation: College of Life Sciences, Longyan University, Longyan, China ; Engineering Research Center for the Prevention and Control of Zoonosis, Longyan, China.

ABSTRACT

Background: Parasitic nematodes cause animal and human diseases of major socio-economic importance worldwide. The suppression of parasite development at particular developmental stages could provide an alternative approach for nematode control. In this study, Ascaris suum was used as a model system in the study of the differentially expressed genes in the infective L3 stage.

Methods: The gene (07E12) was screened and identified from the subtractive cDNA library for the infective larvae of Ascaris suum using real-time quantitative PCR. Then, the full-length cDNA of 07E12 was characterized by 3' and 5' rapid amplification of cDNA ends (RACE). The characteristics of the gene were further analyzed using bioinformatic analyses.

Results: The results showed that the gene 07E12 was differentially expressed in the third-stage larvae of A. suum and its expression level in the infective larvae was much higher than in other stages. It was shown that the gene 07E12 had 99% identity with the corresponding sequences of the A. suum whole genome shotgun sequence containing the homologous sequences with conserved sequences of Neuropeptide-Like Protein family member. Likewise, by performing BLASTN and BLASTP searches in the GenBank™, it was shown that this gene had 99 % identity with A. suum cre-nlp-2 protein.

Conclusion: This gene 07E12 which is differentially expressed in the third-stage larvae of A. suum may encode a neuropeptide-like protein family member, a very important molecule in the process of infecting a host.

No MeSH data available.


Related in: MedlinePlus

Verification result of the assembled full-length cDNA. Lane M represents the DL 2000 DNA size marker (Takara). Lane 1 represents the overlapping 3’ end cDNA and 5’ end cDNA. Lane 2 is the negative control
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC4386041&req=5

Figure 2: Verification result of the assembled full-length cDNA. Lane M represents the DL 2000 DNA size marker (Takara). Lane 1 represents the overlapping 3’ end cDNA and 5’ end cDNA. Lane 2 is the negative control

Mentions: The 3' and 5' RACE products for 07E12 were amplified and characterized. Sequencing revealed that the 3' RACE sequence was 699 bp in length, while the 5' RACE sequence was 539 bp long. The 3' and 5' RACE sequences were edited and assembled, giving a full-length for gene 07E12 of 719 bp. The primers were designed (F: 5'- AGTGTTCCATTTGAATGTGT -3' and R: 5'- GCATGGCATAAACAAAATTCTG -3') according to the assembled sequence and the full-length cDNA was verified (Fig. 2). The full-length cDNA has an open reading frame (ORF) of 558 bp and similar sequences were identified by performing BLASTN searches in the GenBank™. This gene has 99 % identity with A. suum whole genome shotgun sequence (accession no. AEUI02000055, ANBK01004475 and AMPH01002048), but was found to be an uncharacterized gene and could encode Neuropeptide-Like Protein family member (nlp-2). The full-length nucleotide sequence was deposited in the GenBank™ database and assigned the accession no. JZ107277. The deduced amino acid sequence from the ORF of gene 07E12 had a predicted molecular mass of 20.68 kDa and 185 amino acids. Similar sequences were identified by performing BLASTP searches in the GenBank™. A multiple sequence alignment of the deduced amino acids of gene 07E12 ORF with other relevant sequences is shown in Fig. 3. The translated ORF of A. suum gene 07E12 shared 99% identity with A. suum cre-nlp-2 protein and has homologous conserved sequences of Neuropeptide-Like Protein family member (SMAMGRLGLRP and SIALGRSGFRP). In addition, the translated ORF of gene 07E12 has 55%, 54%, 54% and 48% identities with the putative 19.60 kDa cre-nlp-2 protein of Caenorhabditis remanei, 19.40 kDa nlp-2 protein of C.elegans, 19.39 kDa cbn-nlp-2 protein of C. brenneri, and 19.20 kDa cbr-nlp-2 protein of C. briggsae, respectively.


Identification and Characterization of a Differentially Expressed Gene (07E12) in the Infective Larvae of the Parasitic Nematode Ascaris suum.

Huang C, You J, Nai F - Iran J Parasitol (2014 Apr-Jun)

Verification result of the assembled full-length cDNA. Lane M represents the DL 2000 DNA size marker (Takara). Lane 1 represents the overlapping 3’ end cDNA and 5’ end cDNA. Lane 2 is the negative control
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC4386041&req=5

Figure 2: Verification result of the assembled full-length cDNA. Lane M represents the DL 2000 DNA size marker (Takara). Lane 1 represents the overlapping 3’ end cDNA and 5’ end cDNA. Lane 2 is the negative control
Mentions: The 3' and 5' RACE products for 07E12 were amplified and characterized. Sequencing revealed that the 3' RACE sequence was 699 bp in length, while the 5' RACE sequence was 539 bp long. The 3' and 5' RACE sequences were edited and assembled, giving a full-length for gene 07E12 of 719 bp. The primers were designed (F: 5'- AGTGTTCCATTTGAATGTGT -3' and R: 5'- GCATGGCATAAACAAAATTCTG -3') according to the assembled sequence and the full-length cDNA was verified (Fig. 2). The full-length cDNA has an open reading frame (ORF) of 558 bp and similar sequences were identified by performing BLASTN searches in the GenBank™. This gene has 99 % identity with A. suum whole genome shotgun sequence (accession no. AEUI02000055, ANBK01004475 and AMPH01002048), but was found to be an uncharacterized gene and could encode Neuropeptide-Like Protein family member (nlp-2). The full-length nucleotide sequence was deposited in the GenBank™ database and assigned the accession no. JZ107277. The deduced amino acid sequence from the ORF of gene 07E12 had a predicted molecular mass of 20.68 kDa and 185 amino acids. Similar sequences were identified by performing BLASTP searches in the GenBank™. A multiple sequence alignment of the deduced amino acids of gene 07E12 ORF with other relevant sequences is shown in Fig. 3. The translated ORF of A. suum gene 07E12 shared 99% identity with A. suum cre-nlp-2 protein and has homologous conserved sequences of Neuropeptide-Like Protein family member (SMAMGRLGLRP and SIALGRSGFRP). In addition, the translated ORF of gene 07E12 has 55%, 54%, 54% and 48% identities with the putative 19.60 kDa cre-nlp-2 protein of Caenorhabditis remanei, 19.40 kDa nlp-2 protein of C.elegans, 19.39 kDa cbn-nlp-2 protein of C. brenneri, and 19.20 kDa cbr-nlp-2 protein of C. briggsae, respectively.

Bottom Line: The results showed that the gene 07E12 was differentially expressed in the third-stage larvae of A. suum and its expression level in the infective larvae was much higher than in other stages.Likewise, by performing BLASTN and BLASTP searches in the GenBank™, it was shown that this gene had 99 % identity with A. suum cre-nlp-2 protein.This gene 07E12 which is differentially expressed in the third-stage larvae of A. suum may encode a neuropeptide-like protein family member, a very important molecule in the process of infecting a host.

View Article: PubMed Central - PubMed

Affiliation: College of Life Sciences, Longyan University, Longyan, China ; Engineering Research Center for the Prevention and Control of Zoonosis, Longyan, China.

ABSTRACT

Background: Parasitic nematodes cause animal and human diseases of major socio-economic importance worldwide. The suppression of parasite development at particular developmental stages could provide an alternative approach for nematode control. In this study, Ascaris suum was used as a model system in the study of the differentially expressed genes in the infective L3 stage.

Methods: The gene (07E12) was screened and identified from the subtractive cDNA library for the infective larvae of Ascaris suum using real-time quantitative PCR. Then, the full-length cDNA of 07E12 was characterized by 3' and 5' rapid amplification of cDNA ends (RACE). The characteristics of the gene were further analyzed using bioinformatic analyses.

Results: The results showed that the gene 07E12 was differentially expressed in the third-stage larvae of A. suum and its expression level in the infective larvae was much higher than in other stages. It was shown that the gene 07E12 had 99% identity with the corresponding sequences of the A. suum whole genome shotgun sequence containing the homologous sequences with conserved sequences of Neuropeptide-Like Protein family member. Likewise, by performing BLASTN and BLASTP searches in the GenBank™, it was shown that this gene had 99 % identity with A. suum cre-nlp-2 protein.

Conclusion: This gene 07E12 which is differentially expressed in the third-stage larvae of A. suum may encode a neuropeptide-like protein family member, a very important molecule in the process of infecting a host.

No MeSH data available.


Related in: MedlinePlus