Limits...
tRFdb: a database for transfer RNA fragments.

Kumar P, Mudunuri SB, Anaya J, Dutta A - Nucleic Acids Res. (2014)

Bottom Line: The database can be searched by tRF ID or tRF sequence, and the results can be limited by organism.The search results show the genome coordinates and names of the tRNAs the sequence may derive from, and there are links for the sequence of the tRF and parental tRNA, and links for the read counts in all the corresponding small RNA libraries.As a case study for how this database may be used, we have shown that a certain class of tRFs, tRF-1s, is highly upregulated in B-cell malignancies.

View Article: PubMed Central - PubMed

Affiliation: Department of Biochemistry and Molecular Genetics, University of Virginia School of Medicine, Charlottesville, VA 22901, USA.

Show MeSH

Related in: MedlinePlus

The patterns of small RNA deep sequencing reads (GSM416733) mapping to tRNA genes. Examples of small RNA reads that mapped to specific tRNAs are shown. More than 80% of reads for a given tRF-1, -3 or -5 represent one or two most abundant reads and this is the read that is included as the main tRF sequence in the database. The most abundant clones are shown in green. Upper: tRF-1-like sequences mapping to the primary tRNA chr17.trna7-SerGCT. Middle: tRF-3-like sequences mapping to the mature tRNA chr6.trna126-LeuAAG. Lower: tRF-5-like sequences mapping to the mature tRNA chr6.trna126-LeuAAG.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4383946&req=5

Figure 2: The patterns of small RNA deep sequencing reads (GSM416733) mapping to tRNA genes. Examples of small RNA reads that mapped to specific tRNAs are shown. More than 80% of reads for a given tRF-1, -3 or -5 represent one or two most abundant reads and this is the read that is included as the main tRF sequence in the database. The most abundant clones are shown in green. Upper: tRF-1-like sequences mapping to the primary tRNA chr17.trna7-SerGCT. Middle: tRF-3-like sequences mapping to the mature tRNA chr6.trna126-LeuAAG. Lower: tRF-5-like sequences mapping to the mature tRNA chr6.trna126-LeuAAG.

Mentions: The ends of the small RNA mapped on tRNA genes was used to assess the significant enrichment of any mapped small RNA on tRNA. The small RNA mostly (>90% of total mapped reads on individual tRNA) mapped on three specific regions: extreme 5′ end (tRF-5), extreme 3′ end (tRF-3) of mature tRNA and 3′ trailer region (tRF-1) of primary tRNA genes. Therefore, tRFs mapped only to these specific locations were considered for building of database. As shown in Figure 2, for each tRF, there is one or two most abundant RNA sequenced (e.g. the tRF-5 ‘GCATTGGTGGTTCAGTGGTAGA’ was sequenced at 8258 reads per million (RPM)) accounting for more than 80% of the reads mapping to that site. This distinguishes the main tRF from other low abundance products created by nucleases digesting the main tRF, or possibly from random degradation of tRNAs and tRFs.


tRFdb: a database for transfer RNA fragments.

Kumar P, Mudunuri SB, Anaya J, Dutta A - Nucleic Acids Res. (2014)

The patterns of small RNA deep sequencing reads (GSM416733) mapping to tRNA genes. Examples of small RNA reads that mapped to specific tRNAs are shown. More than 80% of reads for a given tRF-1, -3 or -5 represent one or two most abundant reads and this is the read that is included as the main tRF sequence in the database. The most abundant clones are shown in green. Upper: tRF-1-like sequences mapping to the primary tRNA chr17.trna7-SerGCT. Middle: tRF-3-like sequences mapping to the mature tRNA chr6.trna126-LeuAAG. Lower: tRF-5-like sequences mapping to the mature tRNA chr6.trna126-LeuAAG.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4383946&req=5

Figure 2: The patterns of small RNA deep sequencing reads (GSM416733) mapping to tRNA genes. Examples of small RNA reads that mapped to specific tRNAs are shown. More than 80% of reads for a given tRF-1, -3 or -5 represent one or two most abundant reads and this is the read that is included as the main tRF sequence in the database. The most abundant clones are shown in green. Upper: tRF-1-like sequences mapping to the primary tRNA chr17.trna7-SerGCT. Middle: tRF-3-like sequences mapping to the mature tRNA chr6.trna126-LeuAAG. Lower: tRF-5-like sequences mapping to the mature tRNA chr6.trna126-LeuAAG.
Mentions: The ends of the small RNA mapped on tRNA genes was used to assess the significant enrichment of any mapped small RNA on tRNA. The small RNA mostly (>90% of total mapped reads on individual tRNA) mapped on three specific regions: extreme 5′ end (tRF-5), extreme 3′ end (tRF-3) of mature tRNA and 3′ trailer region (tRF-1) of primary tRNA genes. Therefore, tRFs mapped only to these specific locations were considered for building of database. As shown in Figure 2, for each tRF, there is one or two most abundant RNA sequenced (e.g. the tRF-5 ‘GCATTGGTGGTTCAGTGGTAGA’ was sequenced at 8258 reads per million (RPM)) accounting for more than 80% of the reads mapping to that site. This distinguishes the main tRF from other low abundance products created by nucleases digesting the main tRF, or possibly from random degradation of tRNAs and tRFs.

Bottom Line: The database can be searched by tRF ID or tRF sequence, and the results can be limited by organism.The search results show the genome coordinates and names of the tRNAs the sequence may derive from, and there are links for the sequence of the tRF and parental tRNA, and links for the read counts in all the corresponding small RNA libraries.As a case study for how this database may be used, we have shown that a certain class of tRFs, tRF-1s, is highly upregulated in B-cell malignancies.

View Article: PubMed Central - PubMed

Affiliation: Department of Biochemistry and Molecular Genetics, University of Virginia School of Medicine, Charlottesville, VA 22901, USA.

Show MeSH
Related in: MedlinePlus