Limits...
Development and characterization of an enhanced nonviral expression vector for electroporation cancer treatment.

Forde PF, Hall LJ, Sadadcharam M, de Kruijf M, O' Sullivan GC, Soden DM - Mol Ther Methods Clin Dev (2014)

Bottom Line: However, it does not guarantee further transport of the DNA from the cytoplasm to the nucleus for subsequent mRNA expression, resulting in varying degrees of exogenous gene translation and a major limitation in comparison to viral approaches.We have demonstrated that our EEV is capable of achieving high levels of expression in a variety of tissue types.Antitumor effects of pEEV were demonstrated by the delayed growth and increased survival of the nontherapeutic pEEV-treated CT26 tumor model.

View Article: PubMed Central - PubMed

Affiliation: Cork Cancer Research Centre, Leslie C Quick Laboratory, BioSciences Institute, University College Cork , Cork, Ireland.

ABSTRACT
Nonviral plasmid DNA gene therapy represents a promising approach for the treatment of many diseases including cancer. Intracellular delivery of DNA can be achieved with the application of electroporation, which facilitates the initial transport of exogenous DNA across the cell membrane into the cytoplasm. However, it does not guarantee further transport of the DNA from the cytoplasm to the nucleus for subsequent mRNA expression, resulting in varying degrees of exogenous gene translation and a major limitation in comparison to viral approaches. To overcome these expression difficulties, we developed a proof-of-concept vector enhanced expression vector (EEV), which incorporates elements from viral systems including nuclear localization sequences and a viral replicase from the Semliki Forest virus. The replicase allows for cytoplasmic mRNA expression and bypasses the need for nuclear localization to generate high levels of gene expression. We have demonstrated that our EEV is capable of achieving high levels of expression in a variety of tissue types. Antitumor effects of pEEV were demonstrated by the delayed growth and increased survival of the nontherapeutic pEEV-treated CT26 tumor model. Using a novel endoscopic electroporation system, EndoVe, we demonstrate and compare, for the first time, both standard cytomegalovirus (CMV) promoter-driven plasmid and EEV gene expression in intraluminal porcine tissues. Our EEV plasmid displays reliable and superior expression capability, and due to its inherent induced oncolytic activity in transfected cells, it may enhance the efficacy and safety of several cancer immunogene therapy approaches.

No MeSH data available.


Related in: MedlinePlus

Plasmid construct. Schematic representation of the circular enhanced expression vector (EEV) plasmid constructed for this study. The circular pEEV construct incorporates a CMV IE/T7 promoter, an Semliki Forest virus (SFV) replicase (nonstructural proteins 1–4), nuclear localization sequence, the entire SFV capsid gene, which functions as a self-cleaving translation enhancer, an Ori colE1 (Ori), 26S subgenomic promoter, capsid (CAP) gene and an ampicillin resistance cassette (AmpR).
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4362347&req=5

fig1: Plasmid construct. Schematic representation of the circular enhanced expression vector (EEV) plasmid constructed for this study. The circular pEEV construct incorporates a CMV IE/T7 promoter, an Semliki Forest virus (SFV) replicase (nonstructural proteins 1–4), nuclear localization sequence, the entire SFV capsid gene, which functions as a self-cleaving translation enhancer, an Ori colE1 (Ori), 26S subgenomic promoter, capsid (CAP) gene and an ampicillin resistance cassette (AmpR).

Mentions: The EEV construct consists of the cytomegalovirus (CMV) IE/T7 promoter and SV40 polyadenylation (pA) (Figure 1). It includes the entire SFV capsid gene, which functions as a self-cleaving translation enhancer, an Ori colE1 (Ori) and capsid (CAP) gene. It also includes the SFV 1–4 nonstructural components and an ampicillin resistance cassette. To this, an expanded multiple cloning site was incorporated for the inclusion of foreign transcripts. For our study, the lacZ transcript was incorporated. A nuclear localization sequence: CACATAACGGGAGGGCCGGCGGTTACCAGGTCGACGGATATGACGGCAGG was inserted to allow for better transport in the nucleus.


Development and characterization of an enhanced nonviral expression vector for electroporation cancer treatment.

Forde PF, Hall LJ, Sadadcharam M, de Kruijf M, O' Sullivan GC, Soden DM - Mol Ther Methods Clin Dev (2014)

Plasmid construct. Schematic representation of the circular enhanced expression vector (EEV) plasmid constructed for this study. The circular pEEV construct incorporates a CMV IE/T7 promoter, an Semliki Forest virus (SFV) replicase (nonstructural proteins 1–4), nuclear localization sequence, the entire SFV capsid gene, which functions as a self-cleaving translation enhancer, an Ori colE1 (Ori), 26S subgenomic promoter, capsid (CAP) gene and an ampicillin resistance cassette (AmpR).
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4362347&req=5

fig1: Plasmid construct. Schematic representation of the circular enhanced expression vector (EEV) plasmid constructed for this study. The circular pEEV construct incorporates a CMV IE/T7 promoter, an Semliki Forest virus (SFV) replicase (nonstructural proteins 1–4), nuclear localization sequence, the entire SFV capsid gene, which functions as a self-cleaving translation enhancer, an Ori colE1 (Ori), 26S subgenomic promoter, capsid (CAP) gene and an ampicillin resistance cassette (AmpR).
Mentions: The EEV construct consists of the cytomegalovirus (CMV) IE/T7 promoter and SV40 polyadenylation (pA) (Figure 1). It includes the entire SFV capsid gene, which functions as a self-cleaving translation enhancer, an Ori colE1 (Ori) and capsid (CAP) gene. It also includes the SFV 1–4 nonstructural components and an ampicillin resistance cassette. To this, an expanded multiple cloning site was incorporated for the inclusion of foreign transcripts. For our study, the lacZ transcript was incorporated. A nuclear localization sequence: CACATAACGGGAGGGCCGGCGGTTACCAGGTCGACGGATATGACGGCAGG was inserted to allow for better transport in the nucleus.

Bottom Line: However, it does not guarantee further transport of the DNA from the cytoplasm to the nucleus for subsequent mRNA expression, resulting in varying degrees of exogenous gene translation and a major limitation in comparison to viral approaches.We have demonstrated that our EEV is capable of achieving high levels of expression in a variety of tissue types.Antitumor effects of pEEV were demonstrated by the delayed growth and increased survival of the nontherapeutic pEEV-treated CT26 tumor model.

View Article: PubMed Central - PubMed

Affiliation: Cork Cancer Research Centre, Leslie C Quick Laboratory, BioSciences Institute, University College Cork , Cork, Ireland.

ABSTRACT
Nonviral plasmid DNA gene therapy represents a promising approach for the treatment of many diseases including cancer. Intracellular delivery of DNA can be achieved with the application of electroporation, which facilitates the initial transport of exogenous DNA across the cell membrane into the cytoplasm. However, it does not guarantee further transport of the DNA from the cytoplasm to the nucleus for subsequent mRNA expression, resulting in varying degrees of exogenous gene translation and a major limitation in comparison to viral approaches. To overcome these expression difficulties, we developed a proof-of-concept vector enhanced expression vector (EEV), which incorporates elements from viral systems including nuclear localization sequences and a viral replicase from the Semliki Forest virus. The replicase allows for cytoplasmic mRNA expression and bypasses the need for nuclear localization to generate high levels of gene expression. We have demonstrated that our EEV is capable of achieving high levels of expression in a variety of tissue types. Antitumor effects of pEEV were demonstrated by the delayed growth and increased survival of the nontherapeutic pEEV-treated CT26 tumor model. Using a novel endoscopic electroporation system, EndoVe, we demonstrate and compare, for the first time, both standard cytomegalovirus (CMV) promoter-driven plasmid and EEV gene expression in intraluminal porcine tissues. Our EEV plasmid displays reliable and superior expression capability, and due to its inherent induced oncolytic activity in transfected cells, it may enhance the efficacy and safety of several cancer immunogene therapy approaches.

No MeSH data available.


Related in: MedlinePlus