Limits...
Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

Ximenes C, Brandão E, Oliveira P, Rocha A, Rego T, Medeiros R, Aguiar-Santos A, Ferraz J, Reis C, Araujo P, Carvalho L, Melo FL - Mem. Inst. Oswaldo Cruz (2014)

Bottom Line: The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites.Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples.This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

View Article: PubMed Central - PubMed

Affiliation: Serviço de Referência Nacional em Filarioses, Departamento de Parasitologia, Centro de Pesquisas Aggeu Magalhães-Fiocruz, Recife, PE, Brasil.

ABSTRACT
The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

Show MeSH

Related in: MedlinePlus

: multiple alignments of the primers WbR (Wb), WbF and Wb2.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4325614&req=5

f01: : multiple alignments of the primers WbR (Wb), WbF and Wb2.

Mentions: PCR-based systems for detection of W. bancrofti DNA - The primers usedwere WbR (anti-sense; 5’TTGTTCCTCTATTTGAGACC3’), WbF (sense; 5’CACCGGTATCGAGATTAATT3’)and Wb2 (anti-sense; 5’TGGATGTATGTCAAAAAGCA3’), the target of which is a tandem-specificregion for W. bancrofti (Kanjanavas etal. 2005) and a multiple alignment of primers can be seen in Fig. 1.


Detection of Wuchereria bancrofti DNA in paired serum and urine samples using polymerase chain reaction-based systems.

Ximenes C, Brandão E, Oliveira P, Rocha A, Rego T, Medeiros R, Aguiar-Santos A, Ferraz J, Reis C, Araujo P, Carvalho L, Melo FL - Mem. Inst. Oswaldo Cruz (2014)

: multiple alignments of the primers WbR (Wb), WbF and Wb2.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4325614&req=5

f01: : multiple alignments of the primers WbR (Wb), WbF and Wb2.
Mentions: PCR-based systems for detection of W. bancrofti DNA - The primers usedwere WbR (anti-sense; 5’TTGTTCCTCTATTTGAGACC3’), WbF (sense; 5’CACCGGTATCGAGATTAATT3’)and Wb2 (anti-sense; 5’TGGATGTATGTCAAAAAGCA3’), the target of which is a tandem-specificregion for W. bancrofti (Kanjanavas etal. 2005) and a multiple alignment of primers can be seen in Fig. 1.

Bottom Line: The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites.Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples.This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

View Article: PubMed Central - PubMed

Affiliation: Serviço de Referência Nacional em Filarioses, Departamento de Parasitologia, Centro de Pesquisas Aggeu Magalhães-Fiocruz, Recife, PE, Brasil.

ABSTRACT
The Global Program for the Elimination of Lymphatic Filariasis (GPELF) aims to eliminate this disease by the year 2020. However, the development of more specific and sensitive tests is important for the success of the GPELF. The present study aimed to standardise polymerase chain reaction (PCR)-based systems for the diagnosis of filariasis in serum and urine. Twenty paired biological urine and serum samples from individuals already known to be positive for Wuchereria bancrofti were collected during the day. Conventional PCR and semi-nested PCR assays were optimised. The detection limit of the technique for purified W. bancrofti DNA extracted from adult worms was 10 fg for the internal systems (WbF/Wb2) and 0.1 fg by using semi-nested PCR. The specificity of the primers was confirmed experimentally by amplification of 1 ng of purified genomic DNA from other species of parasites. Evaluation of the paired urine and serum samples by the semi-nested PCR technique indicated only two of the 20 tested individuals were positive, whereas the simple internal PCR system (WbF/Wb2), which has highly promising performance, revealed that all the patients were positive using both samples. This study successfully demonstrated the possibility of using the PCR technique on urine for the diagnosis of W. bancrofti infection.

Show MeSH
Related in: MedlinePlus