Limits...
Preparation and characterization of anti-tissue factor single-chain variable fragment antibody for cancer diagnosis.

Sato R, Obonai T, Tsumura R, Tsumoto K, Koga Y, Yasunaga M, Matsumura Y - Cancer Sci. (2014)

Bottom Line: Tissue factor (TF), which serves as the initiator of the extrinsic blood coagulation cascade, has been found to be overexpressed in various solid tumors, especially brain tumors, pancreatic cancer, and gastric cancer.The data obtained showed that the affinity of the anti-TF scFv was 2.04 × 10(-8) (KD), and that the protein showed significant binding to the cancer cells.This study indicates anti-TF scFv may be suitable as an imaging probe for the diagnosis of solid tumors.

View Article: PubMed Central - PubMed

Affiliation: Division of Developmental Therapeutics, Research Center for Innovative Oncology, National Cancer Center Hospital East, Chiba, Japan; Laboratory of Cancer Biology, Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba, Japan.

Show MeSH

Related in: MedlinePlus

Plasmid construction of the single-chain variable region (scFv).
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4317963&req=5

fig01: Plasmid construction of the single-chain variable region (scFv).

Mentions: Anti-mTF mAb, clone 1157, was developed by us. Total RNA was extracted from clone 1157 hybridoma cells and cDNA was synthesized from the total RNA. The cDNA of the 1157 VL and VH were then amplified by PCR (a thermal cycling program consisting of 35 cycles of 94°C for 15 s, 55°C for 15 s, and 68°C for 1 min using mix primers, according to the method described in a previous report.(13) Each amplified product was then re-amplified using the following primers to add restriction enzyme sites: 5′ CATGCCATGGGGGACATTGTGTTAACACAGTCTCC 3′ (forward) and 5′ GGCGGCGGCTGATTTCCAGTTTGGTCCCCCCTCC 3′ (reverse) for VL, and 5′GGATATCGAGGTGATGTTGGTGGAGTCGGGAGGAG 3′ (forward) and 5′ TCCCGGCGGCTGAGGAGACTGTGACCATGACTCCT 3′ (reverse) for VH. A 6-His tag and Cys residues were fused, and the commonly used linker (Gly4-Ser)3 was set between the VL and VH. Finally, this expression vector was designated as the pRA2 vector (Fig. 1). The anti-mTF scFv expression vector was transfected into Escherichia coli BL21 (Takara Bio, Tokyo, Japan), followed by incubation of the bacterial cells at 37°C for 18 h on LB-agar (Takara Bio) containing 200 μg/mL ampicilin (Wako). And then the selected cells were allowed to grow in 2× YT medium containing 200 μg/mL ampicilin until the turbidity level reached 0.6 at O.D. 600. Then, isopropyl β-D-1-thiogalactopyranoside was added into the medium to become 500 μM. The cells were then cultured at 37°C for further 6 h, harvested by centrifugation (8000 g, 30 min, 4°C), and suspended in a buffer composed of 500 mM NaCl and 20 mM Tris-HCl (pH 8.0 at 4°C). The pellet was sonicated (model UD-201, TOMY, Tokyo, Japan) and then centrifuged (10 000 g, 30 min, 4°C) to separate the supernatant (soluble form) from the pellet (insoluble form). The supernatant was then collected and loaded onto Ni-NTA agarose (Invitrogen). The agarose was washed with a sonication buffer containing 5 mM imidazole. The anti-mTF scFv was eluted with 10, 20, 50, 100, 200, 300 and 500 mM imidazole. The eluate was filtered via Millex-GP (0.22 μm, PES, Merck-Millipore, Darmstadt, Germany). The solution was loaded on to a Superdex75 column (GE Healthcare, Uppsala, Sweden) equilibrated with phosphate buffered saline (PBS). Each fraction was analyzed by SDS-PAGE. The purified anti- mTF scFv and IgG were stored at 4°C until use. The anti-mTF scFv was transferred to a PVDF membrane (Bio-Rad Laboratories, Hercules, CA, USA), which was blocked with 0.3% Difco skim milk (Becton Dickinson, Franklin Lakes, NJ, USA) in PBS. The membranes were then incubated in the presence of 2 μg/mL anti-His-tag mAb conjugated with peroxidase (Wako) and 0.3% skim milk in PBS for 10 min at room temperature (RT). After washing with PBS containing 0.1% Tween 20 (PBS-T, Sigma, St. Louis, MO, USA), the protein on the membranes was visualized using ECL prime (GE Healthcare) as substrate. Optical imaging was carried out with the Chemidoc XRS+ system (Bio-Rad Laboratories).


Preparation and characterization of anti-tissue factor single-chain variable fragment antibody for cancer diagnosis.

Sato R, Obonai T, Tsumura R, Tsumoto K, Koga Y, Yasunaga M, Matsumura Y - Cancer Sci. (2014)

Plasmid construction of the single-chain variable region (scFv).
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4317963&req=5

fig01: Plasmid construction of the single-chain variable region (scFv).
Mentions: Anti-mTF mAb, clone 1157, was developed by us. Total RNA was extracted from clone 1157 hybridoma cells and cDNA was synthesized from the total RNA. The cDNA of the 1157 VL and VH were then amplified by PCR (a thermal cycling program consisting of 35 cycles of 94°C for 15 s, 55°C for 15 s, and 68°C for 1 min using mix primers, according to the method described in a previous report.(13) Each amplified product was then re-amplified using the following primers to add restriction enzyme sites: 5′ CATGCCATGGGGGACATTGTGTTAACACAGTCTCC 3′ (forward) and 5′ GGCGGCGGCTGATTTCCAGTTTGGTCCCCCCTCC 3′ (reverse) for VL, and 5′GGATATCGAGGTGATGTTGGTGGAGTCGGGAGGAG 3′ (forward) and 5′ TCCCGGCGGCTGAGGAGACTGTGACCATGACTCCT 3′ (reverse) for VH. A 6-His tag and Cys residues were fused, and the commonly used linker (Gly4-Ser)3 was set between the VL and VH. Finally, this expression vector was designated as the pRA2 vector (Fig. 1). The anti-mTF scFv expression vector was transfected into Escherichia coli BL21 (Takara Bio, Tokyo, Japan), followed by incubation of the bacterial cells at 37°C for 18 h on LB-agar (Takara Bio) containing 200 μg/mL ampicilin (Wako). And then the selected cells were allowed to grow in 2× YT medium containing 200 μg/mL ampicilin until the turbidity level reached 0.6 at O.D. 600. Then, isopropyl β-D-1-thiogalactopyranoside was added into the medium to become 500 μM. The cells were then cultured at 37°C for further 6 h, harvested by centrifugation (8000 g, 30 min, 4°C), and suspended in a buffer composed of 500 mM NaCl and 20 mM Tris-HCl (pH 8.0 at 4°C). The pellet was sonicated (model UD-201, TOMY, Tokyo, Japan) and then centrifuged (10 000 g, 30 min, 4°C) to separate the supernatant (soluble form) from the pellet (insoluble form). The supernatant was then collected and loaded onto Ni-NTA agarose (Invitrogen). The agarose was washed with a sonication buffer containing 5 mM imidazole. The anti-mTF scFv was eluted with 10, 20, 50, 100, 200, 300 and 500 mM imidazole. The eluate was filtered via Millex-GP (0.22 μm, PES, Merck-Millipore, Darmstadt, Germany). The solution was loaded on to a Superdex75 column (GE Healthcare, Uppsala, Sweden) equilibrated with phosphate buffered saline (PBS). Each fraction was analyzed by SDS-PAGE. The purified anti- mTF scFv and IgG were stored at 4°C until use. The anti-mTF scFv was transferred to a PVDF membrane (Bio-Rad Laboratories, Hercules, CA, USA), which was blocked with 0.3% Difco skim milk (Becton Dickinson, Franklin Lakes, NJ, USA) in PBS. The membranes were then incubated in the presence of 2 μg/mL anti-His-tag mAb conjugated with peroxidase (Wako) and 0.3% skim milk in PBS for 10 min at room temperature (RT). After washing with PBS containing 0.1% Tween 20 (PBS-T, Sigma, St. Louis, MO, USA), the protein on the membranes was visualized using ECL prime (GE Healthcare) as substrate. Optical imaging was carried out with the Chemidoc XRS+ system (Bio-Rad Laboratories).

Bottom Line: Tissue factor (TF), which serves as the initiator of the extrinsic blood coagulation cascade, has been found to be overexpressed in various solid tumors, especially brain tumors, pancreatic cancer, and gastric cancer.The data obtained showed that the affinity of the anti-TF scFv was 2.04 × 10(-8) (KD), and that the protein showed significant binding to the cancer cells.This study indicates anti-TF scFv may be suitable as an imaging probe for the diagnosis of solid tumors.

View Article: PubMed Central - PubMed

Affiliation: Division of Developmental Therapeutics, Research Center for Innovative Oncology, National Cancer Center Hospital East, Chiba, Japan; Laboratory of Cancer Biology, Department of Integrated Biosciences, Graduate School of Frontier Sciences, The University of Tokyo, Chiba, Japan.

Show MeSH
Related in: MedlinePlus