Limits...
Evaluation of cellular responses for a chimeric HBsAg-HCV core DNA vaccine in BALB/c mice.

Yazdanian M, Memarnejadian A, Mahdavi M, Motevalli F, Sadat SM, Vahabpour R, Khanahmad H, Soleimanjahi H, Budkowska A, Roohvand F - Adv Biomed Res (2015)

Bottom Line: The cellular immune responses (proliferation, In vivo CTL assay and IFN-γ/IL-4 ELISpot) against a strong and dominant H2-d restricted, CD8(+)-epitopic peptide (C39) (core 39-48; RRGPRLGVRA) of HCVcp were compared in immunized animals.Proper expression of the fused protein by pCHCORE in transiently transfected HEK 293T cells and in the expected size (around 50 kDa) was confirmed by western blotting.Fusion of HBsAg to HCVcp in the context of a DNA vaccine modality could augment Th1-oriented cellular and CTL responses toward a protective epitope, comparable to that of HCVcp (subunit HCV vaccine) immunization.

View Article: PubMed Central - PubMed

Affiliation: Department of Hepatitis and AIDS, Pasteur Institute of Iran, Tehran, Iran.

ABSTRACT

Background: Fusion of Hepatitis B virus surface antigen (HBsAg) to a DNA construct might be considered as a strategy to enhance cellular and cytotoxic T-lymphocytes (CTL) responses of a Hepatitis C Virus core protein (HCVcp)-based DNA vaccine comparable to that of adjuvanted protein (subunit) immunization.

Materials and methods: pCHCORE vector harboring coding sequence of HBsAg and HCVcp (amino acids 2-120) in tandem within the pCDNA3.1 backbone was constructed. The corresponding recombinant HCVcp was also expressed and purified in Escherichia coli. Mice were immunized either by adjuvanted HCVcp (pluronic acid + protein) or by pCHCORE vector primed/protein boosted immunization regimen. The cellular immune responses (proliferation, In vivo CTL assay and IFN-γ/IL-4 ELISpot) against a strong and dominant H2-d restricted, CD8(+)-epitopic peptide (C39) (core 39-48; RRGPRLGVRA) of HCVcp were compared in immunized animals.

Result: Proper expression of the fused protein by pCHCORE in transiently transfected HEK 293T cells and in the expected size (around 50 kDa) was confirmed by western blotting. The immunization results indicated that the pCHCORE shifted the immune responses pathway to Th1 by enhancing the IFN-γ cytokine level much higher than protein immunization while the proliferative and CTL responses were comparable (or slightly in favor of DNA immunization).

Conclusion: Fusion of HBsAg to HCVcp in the context of a DNA vaccine modality could augment Th1-oriented cellular and CTL responses toward a protective epitope, comparable to that of HCVcp (subunit HCV vaccine) immunization.

No MeSH data available.


Related in: MedlinePlus

Schematic presentation of pCHBS and pCHCORE vector construction. (a) In a previous study[11] the HBsAg was PCR amplified and cloned into HindIII/BamHI restriction enzyme sites of pCDNA3.1 to produce pCHBS vector. K/ATG denotes Kozak/start codon. PCMV and BGH pA show the CMV promoter and bovine growth hormone polyadenylation site, respectively. SV40 ori and SV40 pA denote to the same elements from SV40. (b) Schematic diagram for insertion of HCVcp (2-120) DNA sequence in pCHBS (HBsAg harboring pCDNA3.1 plasmid) to construct the pCHCORE vector
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4300588&req=5

Figure 1: Schematic presentation of pCHBS and pCHCORE vector construction. (a) In a previous study[11] the HBsAg was PCR amplified and cloned into HindIII/BamHI restriction enzyme sites of pCDNA3.1 to produce pCHBS vector. K/ATG denotes Kozak/start codon. PCMV and BGH pA show the CMV promoter and bovine growth hormone polyadenylation site, respectively. SV40 ori and SV40 pA denote to the same elements from SV40. (b) Schematic diagram for insertion of HCVcp (2-120) DNA sequence in pCHBS (HBsAg harboring pCDNA3.1 plasmid) to construct the pCHCORE vector

Mentions: The HCV core (amino acids 2-122) gene was amplified by polymerase chain reaction (PCR) from the same pIVEX2.4a-core plasmid,[2324] which was also used for protein expression in E. coli in the present study (as noted before). The upstream primer contained a BamHI site (underlined) at its 5Ͳ (5’TATGGATCCGGCACGATTCCCAAACC 3’) and the downstream primer harbored an EcoRV site (underlined) and two stop codons (bolded; TCA/TTA) successively at its 5’ site (5’AAGGATATCTCATTACTTACCCAAATTGC3’). Amplification was carried out using Pfu DNA polymerase (fermentas) and by the following protocol: Predenaturation at 94°C for 4 min, and 30 cycles of denaturation at 94°C, annealing at 55°C for 1 min and extension at 72°C for 1 min followed by 10 min at 72°C. The PCR-amplified fragment was treated with BamHI/EcoRV enzymes and the gel purified amplicon was inserted into the same restriction site of the pCHBS eukaryotic expression vector to produce chimeric pCHCORE vector harboring HBsAg and HCV core genes in tandem Figure 1b. Construction of pCHBS vector containing HBsAg coding sequence (ayw serotype; GenBank accession X02496, REGION: 157-837) in HindIII-BamHI sites within a pCDNA3.1 plasmid [Figure 1a] was previously described.[11] Confirmation of the pCHCORE vector was achieved by restriction analyses and sequencing reactions.


Evaluation of cellular responses for a chimeric HBsAg-HCV core DNA vaccine in BALB/c mice.

Yazdanian M, Memarnejadian A, Mahdavi M, Motevalli F, Sadat SM, Vahabpour R, Khanahmad H, Soleimanjahi H, Budkowska A, Roohvand F - Adv Biomed Res (2015)

Schematic presentation of pCHBS and pCHCORE vector construction. (a) In a previous study[11] the HBsAg was PCR amplified and cloned into HindIII/BamHI restriction enzyme sites of pCDNA3.1 to produce pCHBS vector. K/ATG denotes Kozak/start codon. PCMV and BGH pA show the CMV promoter and bovine growth hormone polyadenylation site, respectively. SV40 ori and SV40 pA denote to the same elements from SV40. (b) Schematic diagram for insertion of HCVcp (2-120) DNA sequence in pCHBS (HBsAg harboring pCDNA3.1 plasmid) to construct the pCHCORE vector
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4300588&req=5

Figure 1: Schematic presentation of pCHBS and pCHCORE vector construction. (a) In a previous study[11] the HBsAg was PCR amplified and cloned into HindIII/BamHI restriction enzyme sites of pCDNA3.1 to produce pCHBS vector. K/ATG denotes Kozak/start codon. PCMV and BGH pA show the CMV promoter and bovine growth hormone polyadenylation site, respectively. SV40 ori and SV40 pA denote to the same elements from SV40. (b) Schematic diagram for insertion of HCVcp (2-120) DNA sequence in pCHBS (HBsAg harboring pCDNA3.1 plasmid) to construct the pCHCORE vector
Mentions: The HCV core (amino acids 2-122) gene was amplified by polymerase chain reaction (PCR) from the same pIVEX2.4a-core plasmid,[2324] which was also used for protein expression in E. coli in the present study (as noted before). The upstream primer contained a BamHI site (underlined) at its 5Ͳ (5’TATGGATCCGGCACGATTCCCAAACC 3’) and the downstream primer harbored an EcoRV site (underlined) and two stop codons (bolded; TCA/TTA) successively at its 5’ site (5’AAGGATATCTCATTACTTACCCAAATTGC3’). Amplification was carried out using Pfu DNA polymerase (fermentas) and by the following protocol: Predenaturation at 94°C for 4 min, and 30 cycles of denaturation at 94°C, annealing at 55°C for 1 min and extension at 72°C for 1 min followed by 10 min at 72°C. The PCR-amplified fragment was treated with BamHI/EcoRV enzymes and the gel purified amplicon was inserted into the same restriction site of the pCHBS eukaryotic expression vector to produce chimeric pCHCORE vector harboring HBsAg and HCV core genes in tandem Figure 1b. Construction of pCHBS vector containing HBsAg coding sequence (ayw serotype; GenBank accession X02496, REGION: 157-837) in HindIII-BamHI sites within a pCDNA3.1 plasmid [Figure 1a] was previously described.[11] Confirmation of the pCHCORE vector was achieved by restriction analyses and sequencing reactions.

Bottom Line: The cellular immune responses (proliferation, In vivo CTL assay and IFN-γ/IL-4 ELISpot) against a strong and dominant H2-d restricted, CD8(+)-epitopic peptide (C39) (core 39-48; RRGPRLGVRA) of HCVcp were compared in immunized animals.Proper expression of the fused protein by pCHCORE in transiently transfected HEK 293T cells and in the expected size (around 50 kDa) was confirmed by western blotting.Fusion of HBsAg to HCVcp in the context of a DNA vaccine modality could augment Th1-oriented cellular and CTL responses toward a protective epitope, comparable to that of HCVcp (subunit HCV vaccine) immunization.

View Article: PubMed Central - PubMed

Affiliation: Department of Hepatitis and AIDS, Pasteur Institute of Iran, Tehran, Iran.

ABSTRACT

Background: Fusion of Hepatitis B virus surface antigen (HBsAg) to a DNA construct might be considered as a strategy to enhance cellular and cytotoxic T-lymphocytes (CTL) responses of a Hepatitis C Virus core protein (HCVcp)-based DNA vaccine comparable to that of adjuvanted protein (subunit) immunization.

Materials and methods: pCHCORE vector harboring coding sequence of HBsAg and HCVcp (amino acids 2-120) in tandem within the pCDNA3.1 backbone was constructed. The corresponding recombinant HCVcp was also expressed and purified in Escherichia coli. Mice were immunized either by adjuvanted HCVcp (pluronic acid + protein) or by pCHCORE vector primed/protein boosted immunization regimen. The cellular immune responses (proliferation, In vivo CTL assay and IFN-γ/IL-4 ELISpot) against a strong and dominant H2-d restricted, CD8(+)-epitopic peptide (C39) (core 39-48; RRGPRLGVRA) of HCVcp were compared in immunized animals.

Result: Proper expression of the fused protein by pCHCORE in transiently transfected HEK 293T cells and in the expected size (around 50 kDa) was confirmed by western blotting. The immunization results indicated that the pCHCORE shifted the immune responses pathway to Th1 by enhancing the IFN-γ cytokine level much higher than protein immunization while the proliferative and CTL responses were comparable (or slightly in favor of DNA immunization).

Conclusion: Fusion of HBsAg to HCVcp in the context of a DNA vaccine modality could augment Th1-oriented cellular and CTL responses toward a protective epitope, comparable to that of HCVcp (subunit HCV vaccine) immunization.

No MeSH data available.


Related in: MedlinePlus