Limits...
Effect of galectin-3 on the behavior of Eca‑109 human esophageal cancer cells.

Liang N, Song X, Xie J, Xu D, Liu F, Yu X, Tian Y, Liu Z, Qiao L, Zhang J - Mol Med Rep (2014)

Bottom Line: Compared with non‑transfected and negative control Eca-109 cells, proliferation was increased significantly in the Eca-109/Gal-3 cells (P<0.05).Galectin-3 also significantly reduced Eca-109 cell apoptosis, compared with the two control groups (P=0.007 and P=0.04, respectively).In conclusion, galectin-3 expression was significantly increased in transfected Eca-109 esophageal cancer cells, resulting in enhanced proliferation, migration and invasion, as well as reduced apoptosis.

View Article: PubMed Central - PubMed

Affiliation: Division of Oncology, Department of Graduate, Weifang Medical College, Jinan, Shandong 261053, P.R. China.

ABSTRACT
Galectin-3, a β-galactoside-binding lectin, is a cell adhesion molecule involved in the regulation of tumor progression. However, the importance of galectin-3 in Eca-109 human esophageal cancer cells has not yet been elucidated. In the present study, a lentiviral vector was designed for overexpression of galectin-3 in Eca-109 cells following plasmid‑mediated transfection (Eca-109/Gal-3 cells). A negative lentiviral vector was introduced into Eca-109 cells as a control (Eca‑109/Neo cells). Western blot and reverse transcription-polymerase chain reaction analyses were used to measure the expression levels of galectin-3 protein and mRNA. The proliferation of Eca-109 cells was measured by a cell counting kit-8 assay. Eca-109 cell apoptosis was determined by Annexin V/7-amino-actinomycin double‑staining. The migration and invasion capacity of Eca-109 cells was determined by a Transwell assay. A total of >98% Eca-109 cells were transfected with the lentiviral vector harboring galectin-3, and galectin-3 expression was detected in Eca-109 cells, Eca-109/Gal-3 cells and Eca-109/Neo cells. Compared with non‑transfected and negative control Eca-109 cells, proliferation was increased significantly in the Eca-109/Gal-3 cells (P<0.05). Galectin-3 also significantly reduced Eca-109 cell apoptosis, compared with the two control groups (P=0.007 and P=0.04, respectively). Transwell migration and invasion assays revealed that significantly greater numbers of Eca-109/Gal-3 cells crossed the artificial basement membrane (55.4±3.9) compared with either the non-transfected or negative control Eca-109 cells (30.6±1.5 and 29±2.6 respectively, P<0.05). In conclusion, galectin-3 expression was significantly increased in transfected Eca-109 esophageal cancer cells, resulting in enhanced proliferation, migration and invasion, as well as reduced apoptosis. These data indicate that galectin-3 may be a potential molecular target in the treatment of esophageal cancer.

Show MeSH

Related in: MedlinePlus

Enhanced green fluorescent protein (EGFP) + galectin-3 (Gal-3) immunosignals (100 kDa) were detected in the Eca-109/Gal-3 cells but not in Eca-109 cells without galectin-3 transfection. (A) GV287 plasmid carrier, AgI cleavage. (B) Non-transfected Eca-109 human esophageal cancer cells. (C) (Gal-3)-transfected Eca-109 cells exhibited transfection efficiency >95%. (D and E) Western blot analysis of Gal-3 expression levels in Eca-109, Eca-109/Gal-3 and Eca-109/Neo cells. Gal-3 immunosignals (31 kDa) were detected in Eca-109, Eca-109/Gal-3 and Eca-109/Neo cells. However, signal densities were significantly stronger in Eca-109/Gal-3 cells than in either Eca-109 or Eca-109/Neo cells (P=0.013 and P=0.045, respectively). No significant differences in signal density were detected between Eca-109 and Eca-109/Neo cells (P=0.314).
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4262483&req=5

f1-mmr-11-02-0896: Enhanced green fluorescent protein (EGFP) + galectin-3 (Gal-3) immunosignals (100 kDa) were detected in the Eca-109/Gal-3 cells but not in Eca-109 cells without galectin-3 transfection. (A) GV287 plasmid carrier, AgI cleavage. (B) Non-transfected Eca-109 human esophageal cancer cells. (C) (Gal-3)-transfected Eca-109 cells exhibited transfection efficiency >95%. (D and E) Western blot analysis of Gal-3 expression levels in Eca-109, Eca-109/Gal-3 and Eca-109/Neo cells. Gal-3 immunosignals (31 kDa) were detected in Eca-109, Eca-109/Gal-3 and Eca-109/Neo cells. However, signal densities were significantly stronger in Eca-109/Gal-3 cells than in either Eca-109 or Eca-109/Neo cells (P=0.013 and P=0.045, respectively). No significant differences in signal density were detected between Eca-109 and Eca-109/Neo cells (P=0.314).

Mentions: The following galectin-3 gene sequence: 5′-CAGGAGAGTCATTGTTTGCAA-3′, with a G/C content of 42.1%, was obtained from GenBank (Accession no. NM_02306). Shanghai Ji Kaiji Chemical Technology Co., Ltd. (Shanghai, China) designed the GV287 AgI cleavage lentivirus recombinant target gene plasmid containing enhanced green fluorescent protein (EGFP). This viral vector frame sequences were designed by Shanghai Ji Kaiji Chemical Technology Co., Ltd as viral vector for overexpression of galectin-3 in Eca-109 cells. The viral vector frame sequences were as follows: 5′-TCAGGAGAGTCATTGTTTGCAATTCAAGAGATTGCAAACAATGACTCTCCTGTTTTTTC-3′, 5′-TCGAGA AAAAACAGGAGAGTCATTGTTTGCAATCTCTTGAAT TGCAAACAATGACTCTCCTGA-3′. The target gene segment was ligated into the GV287 vector (Fig. 1A; Shanghai Ji Kaiji Chemical Technology Co., Ltd.).


Effect of galectin-3 on the behavior of Eca‑109 human esophageal cancer cells.

Liang N, Song X, Xie J, Xu D, Liu F, Yu X, Tian Y, Liu Z, Qiao L, Zhang J - Mol Med Rep (2014)

Enhanced green fluorescent protein (EGFP) + galectin-3 (Gal-3) immunosignals (100 kDa) were detected in the Eca-109/Gal-3 cells but not in Eca-109 cells without galectin-3 transfection. (A) GV287 plasmid carrier, AgI cleavage. (B) Non-transfected Eca-109 human esophageal cancer cells. (C) (Gal-3)-transfected Eca-109 cells exhibited transfection efficiency >95%. (D and E) Western blot analysis of Gal-3 expression levels in Eca-109, Eca-109/Gal-3 and Eca-109/Neo cells. Gal-3 immunosignals (31 kDa) were detected in Eca-109, Eca-109/Gal-3 and Eca-109/Neo cells. However, signal densities were significantly stronger in Eca-109/Gal-3 cells than in either Eca-109 or Eca-109/Neo cells (P=0.013 and P=0.045, respectively). No significant differences in signal density were detected between Eca-109 and Eca-109/Neo cells (P=0.314).
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4262483&req=5

f1-mmr-11-02-0896: Enhanced green fluorescent protein (EGFP) + galectin-3 (Gal-3) immunosignals (100 kDa) were detected in the Eca-109/Gal-3 cells but not in Eca-109 cells without galectin-3 transfection. (A) GV287 plasmid carrier, AgI cleavage. (B) Non-transfected Eca-109 human esophageal cancer cells. (C) (Gal-3)-transfected Eca-109 cells exhibited transfection efficiency >95%. (D and E) Western blot analysis of Gal-3 expression levels in Eca-109, Eca-109/Gal-3 and Eca-109/Neo cells. Gal-3 immunosignals (31 kDa) were detected in Eca-109, Eca-109/Gal-3 and Eca-109/Neo cells. However, signal densities were significantly stronger in Eca-109/Gal-3 cells than in either Eca-109 or Eca-109/Neo cells (P=0.013 and P=0.045, respectively). No significant differences in signal density were detected between Eca-109 and Eca-109/Neo cells (P=0.314).
Mentions: The following galectin-3 gene sequence: 5′-CAGGAGAGTCATTGTTTGCAA-3′, with a G/C content of 42.1%, was obtained from GenBank (Accession no. NM_02306). Shanghai Ji Kaiji Chemical Technology Co., Ltd. (Shanghai, China) designed the GV287 AgI cleavage lentivirus recombinant target gene plasmid containing enhanced green fluorescent protein (EGFP). This viral vector frame sequences were designed by Shanghai Ji Kaiji Chemical Technology Co., Ltd as viral vector for overexpression of galectin-3 in Eca-109 cells. The viral vector frame sequences were as follows: 5′-TCAGGAGAGTCATTGTTTGCAATTCAAGAGATTGCAAACAATGACTCTCCTGTTTTTTC-3′, 5′-TCGAGA AAAAACAGGAGAGTCATTGTTTGCAATCTCTTGAAT TGCAAACAATGACTCTCCTGA-3′. The target gene segment was ligated into the GV287 vector (Fig. 1A; Shanghai Ji Kaiji Chemical Technology Co., Ltd.).

Bottom Line: Compared with non‑transfected and negative control Eca-109 cells, proliferation was increased significantly in the Eca-109/Gal-3 cells (P<0.05).Galectin-3 also significantly reduced Eca-109 cell apoptosis, compared with the two control groups (P=0.007 and P=0.04, respectively).In conclusion, galectin-3 expression was significantly increased in transfected Eca-109 esophageal cancer cells, resulting in enhanced proliferation, migration and invasion, as well as reduced apoptosis.

View Article: PubMed Central - PubMed

Affiliation: Division of Oncology, Department of Graduate, Weifang Medical College, Jinan, Shandong 261053, P.R. China.

ABSTRACT
Galectin-3, a β-galactoside-binding lectin, is a cell adhesion molecule involved in the regulation of tumor progression. However, the importance of galectin-3 in Eca-109 human esophageal cancer cells has not yet been elucidated. In the present study, a lentiviral vector was designed for overexpression of galectin-3 in Eca-109 cells following plasmid‑mediated transfection (Eca-109/Gal-3 cells). A negative lentiviral vector was introduced into Eca-109 cells as a control (Eca‑109/Neo cells). Western blot and reverse transcription-polymerase chain reaction analyses were used to measure the expression levels of galectin-3 protein and mRNA. The proliferation of Eca-109 cells was measured by a cell counting kit-8 assay. Eca-109 cell apoptosis was determined by Annexin V/7-amino-actinomycin double‑staining. The migration and invasion capacity of Eca-109 cells was determined by a Transwell assay. A total of >98% Eca-109 cells were transfected with the lentiviral vector harboring galectin-3, and galectin-3 expression was detected in Eca-109 cells, Eca-109/Gal-3 cells and Eca-109/Neo cells. Compared with non‑transfected and negative control Eca-109 cells, proliferation was increased significantly in the Eca-109/Gal-3 cells (P<0.05). Galectin-3 also significantly reduced Eca-109 cell apoptosis, compared with the two control groups (P=0.007 and P=0.04, respectively). Transwell migration and invasion assays revealed that significantly greater numbers of Eca-109/Gal-3 cells crossed the artificial basement membrane (55.4±3.9) compared with either the non-transfected or negative control Eca-109 cells (30.6±1.5 and 29±2.6 respectively, P<0.05). In conclusion, galectin-3 expression was significantly increased in transfected Eca-109 esophageal cancer cells, resulting in enhanced proliferation, migration and invasion, as well as reduced apoptosis. These data indicate that galectin-3 may be a potential molecular target in the treatment of esophageal cancer.

Show MeSH
Related in: MedlinePlus