Limits...
Beadex function in the motor neurons is essential for female reproduction in Drosophila melanogaster.

Kairamkonda S, Nongthomba U - PLoS ONE (2014)

Bottom Line: However, no defect was found in the overall ovariole development.Tissue specific, targeted knock down of Beadex indicated that its function in neurons is important for efficient female reproduction, since its neuronal knock down led to compromised female reproductive abilities, similar to Beadex females.Thus, the present study attributes a novel and essential role for Beadex in female reproduction through neurons.

View Article: PubMed Central - PubMed

Affiliation: Molecular Reproduction, Development and Genetics, Indian Institute of Science, Bangalore, Karnataka, India.

ABSTRACT
Drosophila melanogaster has served as an excellent model system for understanding the neuronal circuits and molecular mechanisms regulating complex behaviors. The Drosophila female reproductive circuits, in particular, are well studied and can be used as a tool to understand the role of novel genes in neuronal function in general and female reproduction in particular. In the present study, the role of Beadex, a transcription co-activator, in Drosophila female reproduction was assessed by generation of mutant and knock down studies. Null allele of Beadex was generated by transposase induced excision of P-element present within an intron of Beadex gene. The mutant showed highly compromised reproductive abilities as evaluated by reduced fecundity and fertility, abnormal oviposition and more importantly, the failure of sperm release from storage organs. However, no defect was found in the overall ovariole development. Tissue specific, targeted knock down of Beadex indicated that its function in neurons is important for efficient female reproduction, since its neuronal knock down led to compromised female reproductive abilities, similar to Beadex females. Further, different neuronal class specific knock down studies revealed that Beadex function is required in motor neurons for normal fecundity and fertility of females. Thus, the present study attributes a novel and essential role for Beadex in female reproduction through neurons.

Show MeSH

Related in: MedlinePlus

Bx  females show compromised reproduction.Bx  allele was generated for assessing their reproductive ability. (A) Genomic location of G14-1 P[GawB] element which was mobilized using Δ2–3 transposase. (C, C') Bx  flies (Bx7) generated showed held-up wings. (D) RT-PCR analysis showed complete absence of Bx-RA and Bx-RB transcript products. (E) PCR amplification of genomic DNA of Bx7 flies showed deletion of ∼2 kb from Bx gene sequence. Position of primers used for the genomic PCR is depicted in A and genomic region deleted in Bx7 is represented in B. (E) Bx7 females have highly reduced fecundity (F, ***, p<0.0001; **, p = 0.0011) and fertility (G, ***, p<0.0001) (no of eggs tested>800 (w1118 and controls), ∼200 (Bx7)) (Students unpaired t-test with Welch's correction) compared to wild type and other controls. (H) almost 100% of the eggs are laid on the surface of the media by Bx7 mutant females compared to control females which deposit upto 90% of the eggs into the media (schematic of eggs laid by control and Bx7 mutant females is shown below the X-axis of the graph) (***, p<0.001, Two way anova with Bonferroni post tests).
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4232528&req=5

pone-0113003-g001: Bx females show compromised reproduction.Bx allele was generated for assessing their reproductive ability. (A) Genomic location of G14-1 P[GawB] element which was mobilized using Δ2–3 transposase. (C, C') Bx flies (Bx7) generated showed held-up wings. (D) RT-PCR analysis showed complete absence of Bx-RA and Bx-RB transcript products. (E) PCR amplification of genomic DNA of Bx7 flies showed deletion of ∼2 kb from Bx gene sequence. Position of primers used for the genomic PCR is depicted in A and genomic region deleted in Bx7 is represented in B. (E) Bx7 females have highly reduced fecundity (F, ***, p<0.0001; **, p = 0.0011) and fertility (G, ***, p<0.0001) (no of eggs tested>800 (w1118 and controls), ∼200 (Bx7)) (Students unpaired t-test with Welch's correction) compared to wild type and other controls. (H) almost 100% of the eggs are laid on the surface of the media by Bx7 mutant females compared to control females which deposit upto 90% of the eggs into the media (schematic of eggs laid by control and Bx7 mutant females is shown below the X-axis of the graph) (***, p<0.001, Two way anova with Bonferroni post tests).

Mentions: RNA from whole body of 1–2 days old w1118 and Bx hop-out flies was isolated using trizol (Sigma) following manufacturer's instructions. From the RNA, 2 µg was taken for making cDNA using first strand cDNA kit following manufacturer's protocol (Thermo Scientific, India). Primers specific for Bx-RA and Bx-RB transcript, were designed as follows- Bx-RAFP 5′ – CTAATTGAGTCGAGTGTGCGTG -3′, Bx-RARP 5′ – AAGGAGGTTGGTTGTCGTCGTC -3′, Bx-RBFP 5′ – ATGGAGTACCTCTACAACGCTA – 3′ and Bx-RBFP 5′ – TTATTTCGGGACCCGTAC – 3′. House-keeping gene rp49 was used as control using following primers rp49FP 5′ – TTCTACCAGCTTCAAGATGAC – 3′ and rp49RP 5′ – GTGTATTCCGACCACGTTACA – 3′. In order to characterize the molecular lesion in hop-out Bx allele, genomic DNA was isolated from wild type (w1118) and isolated Bx mutant (Bx7). Primers were designed on either side of the p{GawB} Bxhdp-G14-1 insertion site (assessed from [21]). The sequences of primers used for PCR amplification of Bx gene region are Bx-FP 5′ – GGCTCGTTGGTCTAGAGGTA – 3′ and Bx-RP 5′ – CATAATGGCATCTCCGCAAG – 3′. The location of the primers in the Bx gene is represented in Figure 1A. PCR amplification of Bx gene region was performed with ExTaq (TaKaRa). The resultant PCR products were analyzed through agarose gel electrophoresis and documented using Alpha DigiDoc RT2 (JH BIO Innovations, India). Further, the PCR product from the Bx mutant was cloned into TA vector (InsTAclone PCR cloning kit, Thermo scientific, India) and sequenced (Amnion, India). The resultant sequences were BLAST aligned against Drosophila genome (http://flybase.org/blast/) to determine the molecular lesion in the Bx mutant.


Beadex function in the motor neurons is essential for female reproduction in Drosophila melanogaster.

Kairamkonda S, Nongthomba U - PLoS ONE (2014)

Bx  females show compromised reproduction.Bx  allele was generated for assessing their reproductive ability. (A) Genomic location of G14-1 P[GawB] element which was mobilized using Δ2–3 transposase. (C, C') Bx  flies (Bx7) generated showed held-up wings. (D) RT-PCR analysis showed complete absence of Bx-RA and Bx-RB transcript products. (E) PCR amplification of genomic DNA of Bx7 flies showed deletion of ∼2 kb from Bx gene sequence. Position of primers used for the genomic PCR is depicted in A and genomic region deleted in Bx7 is represented in B. (E) Bx7 females have highly reduced fecundity (F, ***, p<0.0001; **, p = 0.0011) and fertility (G, ***, p<0.0001) (no of eggs tested>800 (w1118 and controls), ∼200 (Bx7)) (Students unpaired t-test with Welch's correction) compared to wild type and other controls. (H) almost 100% of the eggs are laid on the surface of the media by Bx7 mutant females compared to control females which deposit upto 90% of the eggs into the media (schematic of eggs laid by control and Bx7 mutant females is shown below the X-axis of the graph) (***, p<0.001, Two way anova with Bonferroni post tests).
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4232528&req=5

pone-0113003-g001: Bx females show compromised reproduction.Bx allele was generated for assessing their reproductive ability. (A) Genomic location of G14-1 P[GawB] element which was mobilized using Δ2–3 transposase. (C, C') Bx flies (Bx7) generated showed held-up wings. (D) RT-PCR analysis showed complete absence of Bx-RA and Bx-RB transcript products. (E) PCR amplification of genomic DNA of Bx7 flies showed deletion of ∼2 kb from Bx gene sequence. Position of primers used for the genomic PCR is depicted in A and genomic region deleted in Bx7 is represented in B. (E) Bx7 females have highly reduced fecundity (F, ***, p<0.0001; **, p = 0.0011) and fertility (G, ***, p<0.0001) (no of eggs tested>800 (w1118 and controls), ∼200 (Bx7)) (Students unpaired t-test with Welch's correction) compared to wild type and other controls. (H) almost 100% of the eggs are laid on the surface of the media by Bx7 mutant females compared to control females which deposit upto 90% of the eggs into the media (schematic of eggs laid by control and Bx7 mutant females is shown below the X-axis of the graph) (***, p<0.001, Two way anova with Bonferroni post tests).
Mentions: RNA from whole body of 1–2 days old w1118 and Bx hop-out flies was isolated using trizol (Sigma) following manufacturer's instructions. From the RNA, 2 µg was taken for making cDNA using first strand cDNA kit following manufacturer's protocol (Thermo Scientific, India). Primers specific for Bx-RA and Bx-RB transcript, were designed as follows- Bx-RAFP 5′ – CTAATTGAGTCGAGTGTGCGTG -3′, Bx-RARP 5′ – AAGGAGGTTGGTTGTCGTCGTC -3′, Bx-RBFP 5′ – ATGGAGTACCTCTACAACGCTA – 3′ and Bx-RBFP 5′ – TTATTTCGGGACCCGTAC – 3′. House-keeping gene rp49 was used as control using following primers rp49FP 5′ – TTCTACCAGCTTCAAGATGAC – 3′ and rp49RP 5′ – GTGTATTCCGACCACGTTACA – 3′. In order to characterize the molecular lesion in hop-out Bx allele, genomic DNA was isolated from wild type (w1118) and isolated Bx mutant (Bx7). Primers were designed on either side of the p{GawB} Bxhdp-G14-1 insertion site (assessed from [21]). The sequences of primers used for PCR amplification of Bx gene region are Bx-FP 5′ – GGCTCGTTGGTCTAGAGGTA – 3′ and Bx-RP 5′ – CATAATGGCATCTCCGCAAG – 3′. The location of the primers in the Bx gene is represented in Figure 1A. PCR amplification of Bx gene region was performed with ExTaq (TaKaRa). The resultant PCR products were analyzed through agarose gel electrophoresis and documented using Alpha DigiDoc RT2 (JH BIO Innovations, India). Further, the PCR product from the Bx mutant was cloned into TA vector (InsTAclone PCR cloning kit, Thermo scientific, India) and sequenced (Amnion, India). The resultant sequences were BLAST aligned against Drosophila genome (http://flybase.org/blast/) to determine the molecular lesion in the Bx mutant.

Bottom Line: However, no defect was found in the overall ovariole development.Tissue specific, targeted knock down of Beadex indicated that its function in neurons is important for efficient female reproduction, since its neuronal knock down led to compromised female reproductive abilities, similar to Beadex females.Thus, the present study attributes a novel and essential role for Beadex in female reproduction through neurons.

View Article: PubMed Central - PubMed

Affiliation: Molecular Reproduction, Development and Genetics, Indian Institute of Science, Bangalore, Karnataka, India.

ABSTRACT
Drosophila melanogaster has served as an excellent model system for understanding the neuronal circuits and molecular mechanisms regulating complex behaviors. The Drosophila female reproductive circuits, in particular, are well studied and can be used as a tool to understand the role of novel genes in neuronal function in general and female reproduction in particular. In the present study, the role of Beadex, a transcription co-activator, in Drosophila female reproduction was assessed by generation of mutant and knock down studies. Null allele of Beadex was generated by transposase induced excision of P-element present within an intron of Beadex gene. The mutant showed highly compromised reproductive abilities as evaluated by reduced fecundity and fertility, abnormal oviposition and more importantly, the failure of sperm release from storage organs. However, no defect was found in the overall ovariole development. Tissue specific, targeted knock down of Beadex indicated that its function in neurons is important for efficient female reproduction, since its neuronal knock down led to compromised female reproductive abilities, similar to Beadex females. Further, different neuronal class specific knock down studies revealed that Beadex function is required in motor neurons for normal fecundity and fertility of females. Thus, the present study attributes a novel and essential role for Beadex in female reproduction through neurons.

Show MeSH
Related in: MedlinePlus