Limits...
Deep sequencing identifies noncanonical editing of Ebola and Marburg virus RNAs in infected cells.

Shabman RS, Jabado OJ, Mire CE, Stockwell TB, Edwards M, Mahajan M, Geisbert TW, Basler CF - MBio (2014)

Bottom Line: Further, we found that the well-characterized EBOV GP mRNA editing site is modified at a high frequency during viral genome RNA replication.Additionally, editing hot spots representing sites of apparent adenosine deaminase activity were found in the MARV-Ang NP 3'-untranslated region.These studies identify novel filovirus-host interactions and reveal production of a greater diversity of filoviral gene products than was previously appreciated.

View Article: PubMed Central - PubMed

Affiliation: Institute for Genomics and Multiscale Biology, Icahn School of Medicine at Mount Sinai, New York, New York, USA.

Show MeSH

Related in: MedlinePlus

Insertion frequencies in the MARV-Ang NP homopolymer region at nt 816 to 821. (A) Depiction of the NP mRNA (dark green) and different translation products produced, depending on editing. (B to F) Pie charts depicting the numbers of adenosine residues inserted at the novel site within the MARV-Ang NP ORF. The numbers of A residues were enumerated within the homopolymer region from sequencing reads with 10 nt of matching sequence (underlined in the sequence) directly flanking each side from positions 805 to 831 (GTTCATCTTGCAAAAAACTGATTCAGG). (B) Homopolymer insertion frequency in mRNA of Thp1 cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (C) mRNA from Vero cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (D) Homopolymer insertion frequency in genomic RNA (vRNA) at 1 hpi, determined from an amplicon encompassing the region of interest. (E) The same experiment as in panel D, except that vRNA was assessed at 24 hpi. (F) Insertion frequency from a DNA plasmid containing the MARV-Ang NP ORF.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4222107&req=5

fig4: Insertion frequencies in the MARV-Ang NP homopolymer region at nt 816 to 821. (A) Depiction of the NP mRNA (dark green) and different translation products produced, depending on editing. (B to F) Pie charts depicting the numbers of adenosine residues inserted at the novel site within the MARV-Ang NP ORF. The numbers of A residues were enumerated within the homopolymer region from sequencing reads with 10 nt of matching sequence (underlined in the sequence) directly flanking each side from positions 805 to 831 (GTTCATCTTGCAAAAAACTGATTCAGG). (B) Homopolymer insertion frequency in mRNA of Thp1 cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (C) mRNA from Vero cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (D) Homopolymer insertion frequency in genomic RNA (vRNA) at 1 hpi, determined from an amplicon encompassing the region of interest. (E) The same experiment as in panel D, except that vRNA was assessed at 24 hpi. (F) Insertion frequency from a DNA plasmid containing the MARV-Ang NP ORF.

Mentions: There are no previous reports describing MARV mRNA editing. Therefore, we evaluated the MARV-Ang samples for regions of the genome prone to RNA editing. Of 20 homopolymer regions (6 or more identical nucleotides), our analysis identified two regions where insertions of additional As occurred at a high frequency. In each region, the number of sequencing reads with extra A residues within the homopolymer region were enumerated as described above for EBOV. One site in the NP mRNA (a 6-U repeat on the negative-sense vRNA between positions 816 and 821) had an extra-A insertion frequency of 11.73% (Vero cells) and 7.9% (Thp1 cells) at 24 hpi (Fig. 4A to C). A second region in the L mRNA (a 6-U repeat on the negative-sense vRNA at positions 17810 to 17815) was also identified with extra-A insertion frequencies of 16.54% in Vero cells and 19.54% in Thp1 cells at 24 hpi (Fig. 5A to C; see also Table S6 in the supplemental material). In both regions, editing events were specific to the mRNA, as insertion frequencies derived from amplicons specific for vRNA or plasmid DNA were at or below 1.00% (Fig. 4D to F and 5D to F; see also Table S6).


Deep sequencing identifies noncanonical editing of Ebola and Marburg virus RNAs in infected cells.

Shabman RS, Jabado OJ, Mire CE, Stockwell TB, Edwards M, Mahajan M, Geisbert TW, Basler CF - MBio (2014)

Insertion frequencies in the MARV-Ang NP homopolymer region at nt 816 to 821. (A) Depiction of the NP mRNA (dark green) and different translation products produced, depending on editing. (B to F) Pie charts depicting the numbers of adenosine residues inserted at the novel site within the MARV-Ang NP ORF. The numbers of A residues were enumerated within the homopolymer region from sequencing reads with 10 nt of matching sequence (underlined in the sequence) directly flanking each side from positions 805 to 831 (GTTCATCTTGCAAAAAACTGATTCAGG). (B) Homopolymer insertion frequency in mRNA of Thp1 cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (C) mRNA from Vero cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (D) Homopolymer insertion frequency in genomic RNA (vRNA) at 1 hpi, determined from an amplicon encompassing the region of interest. (E) The same experiment as in panel D, except that vRNA was assessed at 24 hpi. (F) Insertion frequency from a DNA plasmid containing the MARV-Ang NP ORF.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4222107&req=5

fig4: Insertion frequencies in the MARV-Ang NP homopolymer region at nt 816 to 821. (A) Depiction of the NP mRNA (dark green) and different translation products produced, depending on editing. (B to F) Pie charts depicting the numbers of adenosine residues inserted at the novel site within the MARV-Ang NP ORF. The numbers of A residues were enumerated within the homopolymer region from sequencing reads with 10 nt of matching sequence (underlined in the sequence) directly flanking each side from positions 805 to 831 (GTTCATCTTGCAAAAAACTGATTCAGG). (B) Homopolymer insertion frequency in mRNA of Thp1 cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (C) mRNA from Vero cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (D) Homopolymer insertion frequency in genomic RNA (vRNA) at 1 hpi, determined from an amplicon encompassing the region of interest. (E) The same experiment as in panel D, except that vRNA was assessed at 24 hpi. (F) Insertion frequency from a DNA plasmid containing the MARV-Ang NP ORF.
Mentions: There are no previous reports describing MARV mRNA editing. Therefore, we evaluated the MARV-Ang samples for regions of the genome prone to RNA editing. Of 20 homopolymer regions (6 or more identical nucleotides), our analysis identified two regions where insertions of additional As occurred at a high frequency. In each region, the number of sequencing reads with extra A residues within the homopolymer region were enumerated as described above for EBOV. One site in the NP mRNA (a 6-U repeat on the negative-sense vRNA between positions 816 and 821) had an extra-A insertion frequency of 11.73% (Vero cells) and 7.9% (Thp1 cells) at 24 hpi (Fig. 4A to C). A second region in the L mRNA (a 6-U repeat on the negative-sense vRNA at positions 17810 to 17815) was also identified with extra-A insertion frequencies of 16.54% in Vero cells and 19.54% in Thp1 cells at 24 hpi (Fig. 5A to C; see also Table S6 in the supplemental material). In both regions, editing events were specific to the mRNA, as insertion frequencies derived from amplicons specific for vRNA or plasmid DNA were at or below 1.00% (Fig. 4D to F and 5D to F; see also Table S6).

Bottom Line: Further, we found that the well-characterized EBOV GP mRNA editing site is modified at a high frequency during viral genome RNA replication.Additionally, editing hot spots representing sites of apparent adenosine deaminase activity were found in the MARV-Ang NP 3'-untranslated region.These studies identify novel filovirus-host interactions and reveal production of a greater diversity of filoviral gene products than was previously appreciated.

View Article: PubMed Central - PubMed

Affiliation: Institute for Genomics and Multiscale Biology, Icahn School of Medicine at Mount Sinai, New York, New York, USA.

Show MeSH
Related in: MedlinePlus