Limits...
Deep sequencing identifies noncanonical editing of Ebola and Marburg virus RNAs in infected cells.

Shabman RS, Jabado OJ, Mire CE, Stockwell TB, Edwards M, Mahajan M, Geisbert TW, Basler CF - MBio (2014)

Bottom Line: Further, we found that the well-characterized EBOV GP mRNA editing site is modified at a high frequency during viral genome RNA replication.Additionally, editing hot spots representing sites of apparent adenosine deaminase activity were found in the MARV-Ang NP 3'-untranslated region.These studies identify novel filovirus-host interactions and reveal production of a greater diversity of filoviral gene products than was previously appreciated.

View Article: PubMed Central - PubMed

Affiliation: Institute for Genomics and Multiscale Biology, Icahn School of Medicine at Mount Sinai, New York, New York, USA.

Show MeSH

Related in: MedlinePlus

Insertion frequencies in the EBOV GP homopolymer region at nt 6378 to 6383. (A) Diagram similar to that in Fig. 2, except the novel GP editing site and the predicted translation product arising from the novel edited mRNA are depicted. (B to G) Pie charts depicting the number of adenosine residues at a novel location with the EBOV GP ORF from either EBOV RNA, control RNA, or control DNA. The numbers of A residues were enumerated within the homopolymer region from Illumina sequencing reads, with 10 nt of matching sequence (underlined in the sequence) directly flanking each side from position 6367 to 6393 (TCTTGAAATCAAAAAACCTGACGGGA). (B) Homopolymer insertion frequency in mRNA of Thp1 cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (C) mRNA from Vero cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (D) Homopolymer insertion frequency in genomic RNA (vRNA) at 1 hpi, determined from an amplicon encompassing the region of interest. (E) The same experiment as depicted in panel D, except that vRNA was assessed at 24 hpi. (F) Insertion frequency from mRNA derived from an RNA polymerase II-driven plasmid expressing EBOV GP mRNA. (G) Insertion frequency from a DNA plasmid harboring the EBOV GP ORF.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4222107&req=5

fig3: Insertion frequencies in the EBOV GP homopolymer region at nt 6378 to 6383. (A) Diagram similar to that in Fig. 2, except the novel GP editing site and the predicted translation product arising from the novel edited mRNA are depicted. (B to G) Pie charts depicting the number of adenosine residues at a novel location with the EBOV GP ORF from either EBOV RNA, control RNA, or control DNA. The numbers of A residues were enumerated within the homopolymer region from Illumina sequencing reads, with 10 nt of matching sequence (underlined in the sequence) directly flanking each side from position 6367 to 6393 (TCTTGAAATCAAAAAACCTGACGGGA). (B) Homopolymer insertion frequency in mRNA of Thp1 cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (C) mRNA from Vero cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (D) Homopolymer insertion frequency in genomic RNA (vRNA) at 1 hpi, determined from an amplicon encompassing the region of interest. (E) The same experiment as depicted in panel D, except that vRNA was assessed at 24 hpi. (F) Insertion frequency from mRNA derived from an RNA polymerase II-driven plasmid expressing EBOV GP mRNA. (G) Insertion frequency from a DNA plasmid harboring the EBOV GP ORF.

Mentions: Within the EBOV genome, there are 25 homopolymer sites of 6 or 7 identical nucleotides. We examined insertion frequencies at each of these sites for our mRNA-Seq data (data not shown). Insertions at select homopolymer regions would lead to a frameshift during protein translation, resulting in truncated protein products with novel C termini of various lengths (Fig. 3A; see also Fig. S2 in the supplemental material). Of these, a site with a high insertion frequency was located in a region corresponding to a stretch of 6 Us (nt 6378 to 6383) on the EBOV vRNA within the EBOV GP gene. This sequence is conserved among all 20 Zaire EBOV full-length annotated genomes outlined in a recent study (28) and in isolates from the 2014 West Africa outbreak from Guinea and Sierra Leone (29) (data not shown), but it appears to be specific for the Zaire species, since there is no corresponding 6-U region in the Sudan, Tai Forest, Bundibugyo, or Reston ebolaviruses (28). The number of A residues in GP mRNAs was enumerated within this homopolymer region. The frequency of a single A insertion ranged between 4.30% and 2.87% in infected Thp1 and Vero cells at 24 hpi (Fig. 3B and C). Nontemplated insertions were present, but at a lower frequency in vRNA-specific amplicons flanking the homopolymer region at 1 and 24 hpi (Fig. 3D and E). Control reactions on plasmid DNA and RNA Pol II-derived mRNA indicated that the observation was specific to the viral polymerase, such that 99.64% and 99.16% of all reads were wild-type sequence, respectively (Fig. 3F and G; see also Table S5 in the supplemental material). These data therefore identify a new site within the EBOV GP gene that undergoes substantial editing, albeit at a lower frequency than the described GP site.


Deep sequencing identifies noncanonical editing of Ebola and Marburg virus RNAs in infected cells.

Shabman RS, Jabado OJ, Mire CE, Stockwell TB, Edwards M, Mahajan M, Geisbert TW, Basler CF - MBio (2014)

Insertion frequencies in the EBOV GP homopolymer region at nt 6378 to 6383. (A) Diagram similar to that in Fig. 2, except the novel GP editing site and the predicted translation product arising from the novel edited mRNA are depicted. (B to G) Pie charts depicting the number of adenosine residues at a novel location with the EBOV GP ORF from either EBOV RNA, control RNA, or control DNA. The numbers of A residues were enumerated within the homopolymer region from Illumina sequencing reads, with 10 nt of matching sequence (underlined in the sequence) directly flanking each side from position 6367 to 6393 (TCTTGAAATCAAAAAACCTGACGGGA). (B) Homopolymer insertion frequency in mRNA of Thp1 cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (C) mRNA from Vero cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (D) Homopolymer insertion frequency in genomic RNA (vRNA) at 1 hpi, determined from an amplicon encompassing the region of interest. (E) The same experiment as depicted in panel D, except that vRNA was assessed at 24 hpi. (F) Insertion frequency from mRNA derived from an RNA polymerase II-driven plasmid expressing EBOV GP mRNA. (G) Insertion frequency from a DNA plasmid harboring the EBOV GP ORF.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4222107&req=5

fig3: Insertion frequencies in the EBOV GP homopolymer region at nt 6378 to 6383. (A) Diagram similar to that in Fig. 2, except the novel GP editing site and the predicted translation product arising from the novel edited mRNA are depicted. (B to G) Pie charts depicting the number of adenosine residues at a novel location with the EBOV GP ORF from either EBOV RNA, control RNA, or control DNA. The numbers of A residues were enumerated within the homopolymer region from Illumina sequencing reads, with 10 nt of matching sequence (underlined in the sequence) directly flanking each side from position 6367 to 6393 (TCTTGAAATCAAAAAACCTGACGGGA). (B) Homopolymer insertion frequency in mRNA of Thp1 cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (C) mRNA from Vero cells at 24 hpi, determined from libraries constructed from chemically sheared RNA. (D) Homopolymer insertion frequency in genomic RNA (vRNA) at 1 hpi, determined from an amplicon encompassing the region of interest. (E) The same experiment as depicted in panel D, except that vRNA was assessed at 24 hpi. (F) Insertion frequency from mRNA derived from an RNA polymerase II-driven plasmid expressing EBOV GP mRNA. (G) Insertion frequency from a DNA plasmid harboring the EBOV GP ORF.
Mentions: Within the EBOV genome, there are 25 homopolymer sites of 6 or 7 identical nucleotides. We examined insertion frequencies at each of these sites for our mRNA-Seq data (data not shown). Insertions at select homopolymer regions would lead to a frameshift during protein translation, resulting in truncated protein products with novel C termini of various lengths (Fig. 3A; see also Fig. S2 in the supplemental material). Of these, a site with a high insertion frequency was located in a region corresponding to a stretch of 6 Us (nt 6378 to 6383) on the EBOV vRNA within the EBOV GP gene. This sequence is conserved among all 20 Zaire EBOV full-length annotated genomes outlined in a recent study (28) and in isolates from the 2014 West Africa outbreak from Guinea and Sierra Leone (29) (data not shown), but it appears to be specific for the Zaire species, since there is no corresponding 6-U region in the Sudan, Tai Forest, Bundibugyo, or Reston ebolaviruses (28). The number of A residues in GP mRNAs was enumerated within this homopolymer region. The frequency of a single A insertion ranged between 4.30% and 2.87% in infected Thp1 and Vero cells at 24 hpi (Fig. 3B and C). Nontemplated insertions were present, but at a lower frequency in vRNA-specific amplicons flanking the homopolymer region at 1 and 24 hpi (Fig. 3D and E). Control reactions on plasmid DNA and RNA Pol II-derived mRNA indicated that the observation was specific to the viral polymerase, such that 99.64% and 99.16% of all reads were wild-type sequence, respectively (Fig. 3F and G; see also Table S5 in the supplemental material). These data therefore identify a new site within the EBOV GP gene that undergoes substantial editing, albeit at a lower frequency than the described GP site.

Bottom Line: Further, we found that the well-characterized EBOV GP mRNA editing site is modified at a high frequency during viral genome RNA replication.Additionally, editing hot spots representing sites of apparent adenosine deaminase activity were found in the MARV-Ang NP 3'-untranslated region.These studies identify novel filovirus-host interactions and reveal production of a greater diversity of filoviral gene products than was previously appreciated.

View Article: PubMed Central - PubMed

Affiliation: Institute for Genomics and Multiscale Biology, Icahn School of Medicine at Mount Sinai, New York, New York, USA.

Show MeSH
Related in: MedlinePlus