Limits...
Dynamics and stability of polymorphic human telomeric G-quadruplex under tension.

You H, Zeng X, Xu Y, Lim CJ, Efremov AK, Phan AT, Yan J - Nucleic Acids Res. (2014)

Bottom Line: This work characterizes the equilibrium transitions of single-molecule telomeric G4 at physiological K(+) concentration.Our results show that the kinetically favored folding pathway is through a short-lived intermediate state to a longer-lived state.In addition, an ultra-long-lived form of telomeric G4 structure with a much stronger mechanical stability is identified.

View Article: PubMed Central - PubMed

Affiliation: Mechanobiology Institute, National University of Singapore, 5A Engineering Drive 1, 117411, Singapore.

Show MeSH

Related in: MedlinePlus

Experimental setup and procedure. (A) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG)3TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence (16,17). (B) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG)3TTT) (top) and the 1:1:1 mixture of three sequences, d(CGAGTCTGTGCACAAGGTGC), d(CTACTGACCTGGCTGC) and d(CTTGTGCACAGACTCGTTGGG(TTAGGG)3TTTGCAGCCAGGTCAGTAGCGAC) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). (C) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.
© Copyright Policy - creative-commons
Related In: Results  -  Collection


getmorefigures.php?uid=PMC4117794&req=5

Figure 1: Experimental setup and procedure. (A) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG)3TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence (16,17). (B) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG)3TTT) (top) and the 1:1:1 mixture of three sequences, d(CGAGTCTGTGCACAAGGTGC), d(CTACTGACCTGGCTGC) and d(CTTGTGCACAGACTCGTTGGG(TTAGGG)3TTTGCAGCCAGGTCAGTAGCGAC) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). (C) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.

Mentions: Ultra stable vertical magnetic tweezers built in lab were used to stretch the DNA constructs using a pair of magnets on the top of the chamber (Figure 1A). The magnetic tweezers were controlled by in-house-written LabVIEW program (National Instruments). The extension change of the construct was recorded with a sampling rate of ∼200 frames per second. Force was controlled by changing the distance between the permanent magnets and flow chamber. Loading rate control was achieved by moving the magnets through a programmed trajectory. The magnetic tweezers have a spatial resolution for bead stuck on surface of ∼2 nm, and the force calibration has a relative error of <10% (32). More details of the magnetic tweezers design, the force and loading rate control, as well as the force calibration were detailed in our previous publications (32,37). All experiments were carried out at our lab room temperature of 21−23 °C.


Dynamics and stability of polymorphic human telomeric G-quadruplex under tension.

You H, Zeng X, Xu Y, Lim CJ, Efremov AK, Phan AT, Yan J - Nucleic Acids Res. (2014)

Experimental setup and procedure. (A) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG)3TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence (16,17). (B) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG)3TTT) (top) and the 1:1:1 mixture of three sequences, d(CGAGTCTGTGCACAAGGTGC), d(CTACTGACCTGGCTGC) and d(CTTGTGCACAGACTCGTTGGG(TTAGGG)3TTTGCAGCCAGGTCAGTAGCGAC) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). (C) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC4117794&req=5

Figure 1: Experimental setup and procedure. (A) Schematic diagram of G4 DNA and magnetic tweezers. The 26 mer ssDNA of four-repeat human telomeric sequence d(TTGGG(TTAGGG)3TTT) is sandwiched bewteen a lower 1449 bp and an upper 601 bp dsDNA handles. The DNA construct is tethered between a 2.8 μm-diameter paramagnetic bead via biotin-streptavidin linkage and an amine functionalized coverslip surface through covalent cross-linker sulfo-SMCC. Inset shows two possible hybrid-type G4 structures that may form on the sequence (16,17). (B) Imino proton NMR spectrum of telomeric G4 sequence d(TTGGG(TTAGGG)3TTT) (top) and the 1:1:1 mixture of three sequences, d(CGAGTCTGTGCACAAGGTGC), d(CTACTGACCTGGCTGC) and d(CTTGTGCACAGACTCGTTGGG(TTAGGG)3TTTGCAGCCAGGTCAGTAGCGAC) (bottom). The mixture is expected to form a G-quadruplex in the centre flanked by two 16-bp Watson–Crick duplexes at the 5′- and 3′-ends respectively (underlined sequences). (C) Typical force responses of G4 DNA in two repeating stretching cycles (original and smoothed extension data are shown in black and red, respectively). In each cycle, a constant force was maintained at 6.5 pN for 60 s then increased to 50 pN at a constant loading rate of 2 pN/s. In the first cycle, at the constant force of 6.5 pN, two extension states with an extension difference of ∼6 nm were observed, indicated by an unfolding transition (up-arrow) followed by a refolding transition (down-arrow) in the zoom-in inset in the orange rectangle. During the subsequent force-increase scan at 2 pN/s, a typical G4 unfolding indicated by a sudden extension jump with a step size of ∼8 nm occurred at ∼25 pN (marked in cyan rectangle). In the second cycle after force was jumped back to 6.5 pN, a refolding transition and a following unfolding transition were observed. In the subsequent force-increase scan at 2 pN/s, G4 unfolding was not observed.
Mentions: Ultra stable vertical magnetic tweezers built in lab were used to stretch the DNA constructs using a pair of magnets on the top of the chamber (Figure 1A). The magnetic tweezers were controlled by in-house-written LabVIEW program (National Instruments). The extension change of the construct was recorded with a sampling rate of ∼200 frames per second. Force was controlled by changing the distance between the permanent magnets and flow chamber. Loading rate control was achieved by moving the magnets through a programmed trajectory. The magnetic tweezers have a spatial resolution for bead stuck on surface of ∼2 nm, and the force calibration has a relative error of <10% (32). More details of the magnetic tweezers design, the force and loading rate control, as well as the force calibration were detailed in our previous publications (32,37). All experiments were carried out at our lab room temperature of 21−23 °C.

Bottom Line: This work characterizes the equilibrium transitions of single-molecule telomeric G4 at physiological K(+) concentration.Our results show that the kinetically favored folding pathway is through a short-lived intermediate state to a longer-lived state.In addition, an ultra-long-lived form of telomeric G4 structure with a much stronger mechanical stability is identified.

View Article: PubMed Central - PubMed

Affiliation: Mechanobiology Institute, National University of Singapore, 5A Engineering Drive 1, 117411, Singapore.

Show MeSH
Related in: MedlinePlus