Limits...
The telomerase inhibitor Gno1p/PINX1 activates the helicase Prp43p during ribosome biogenesis.

Chen YL, Capeyrou R, Humbert O, Mouffok S, Kadri YA, Lebaron S, Henras AK, Henry Y - Nucleic Acids Res. (2014)

Bottom Line: In yeast, lack of Gno1p leads to a decrease in the levels of pre-40S and intermediate pre-60S pre-ribosomal particles, defects that can be corrected by PINX1 expression.G-patch alterations in Gno1p or PINX1 that inhibit their interactions with Prp43p completely abolish their function in yeast ribosome biogenesis.Altogether, our results suggest that activation of Prp43p by Gno1p/PINX1 within early pre-ribosomal particles is crucial for their subsequent maturation.

View Article: PubMed Central - PubMed

Affiliation: Equipe labellisée Ligue Contre le Cancer, LBME, CNRS and Toulouse University, Toulouse 31062, France.

Show MeSH
Analysis of pre-rRNA processing in Δgno1 cells. (A) Northern blot analysis of various (pre)-rRNAs extracted from WT or Δgno1 cells. RNAs were extracted from WT (lanes 1 and 3) or Δgno1 (lanes 2 and 4) cells grown in YPGlu (lanes 1 and 2) or YNBGlu (lanes 3 and 4) media, separated on a 1.2% agarose gel in denaturing conditions, transferred to a nylon membrane and detected using various specific oligonucleotide probes. (B) Primer extension analysis of 27SA3 pre-rRNAs. Primer extensions were carried out using RNAs extracted from WT or Δgno1 cells grown in YPGlu or YNBGlu media as indicated and a kinased primer hybridizing at the 3′ end of internal transcribed spacer 1 (5′TTAATATTTTAAAATTTCCAGTTACGAAAATTC3′). The sequencing ladder was generated using the same kinased primer. (C) Pulse-chase analysis. WT and Δgno1 cells grown at 30°C in YNBGlu medium were incubated for 2 min with 3H-adenine. An excess of cold adenine was then added to the cultures and culture samples were collected at the indicated times after cold adenine addition. Total RNAs were extracted from these samples, separated on a 1.2% agarose gel in denaturing conditions and transferred to a nylon membrane. Labeled RNAs were directly detected by autoradiography.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4066782&req=5

Figure 4: Analysis of pre-rRNA processing in Δgno1 cells. (A) Northern blot analysis of various (pre)-rRNAs extracted from WT or Δgno1 cells. RNAs were extracted from WT (lanes 1 and 3) or Δgno1 (lanes 2 and 4) cells grown in YPGlu (lanes 1 and 2) or YNBGlu (lanes 3 and 4) media, separated on a 1.2% agarose gel in denaturing conditions, transferred to a nylon membrane and detected using various specific oligonucleotide probes. (B) Primer extension analysis of 27SA3 pre-rRNAs. Primer extensions were carried out using RNAs extracted from WT or Δgno1 cells grown in YPGlu or YNBGlu media as indicated and a kinased primer hybridizing at the 3′ end of internal transcribed spacer 1 (5′TTAATATTTTAAAATTTCCAGTTACGAAAATTC3′). The sequencing ladder was generated using the same kinased primer. (C) Pulse-chase analysis. WT and Δgno1 cells grown at 30°C in YNBGlu medium were incubated for 2 min with 3H-adenine. An excess of cold adenine was then added to the cultures and culture samples were collected at the indicated times after cold adenine addition. Total RNAs were extracted from these samples, separated on a 1.2% agarose gel in denaturing conditions and transferred to a nylon membrane. Labeled RNAs were directly detected by autoradiography.

Mentions: Guglielmi and Werner have previously reported (29) increased steady-state levels of 35S pre-rRNA and impaired cleavages at the A0, A1 and A2 sites in Δgno1 cells, resulting in lower 20S pre-rRNA accumulation (see Supplementary Figure S2 for a cartoon of pre-rRNA processing in yeast cells). They did not mention however a defect in the pre-60S pathway, except for a decrease in 27SA2 pre-rRNA levels as assessed by primer extension. We therefore carried out our own northern blot assessment of the relative accumulation levels of various pre-rRNA intermediates in Δgno1 compared to wild-type cells (Figure 4A). As observed by Guglielmi and Werner, we detect an accumulation of the 35S pre-rRNA and a decrease in the steady-state levels of 20S pre-rRNA. There is also a very slight accumulation of the 33/32S pre-rRNAs. 23S pre-rRNA is increased when the Δgno1 strain is grown in rich medium but not when it is grown in selective minimal medium. 27SA2 pre-rRNA levels are not diminished. The same conclusion can in fact be drawn from the northern analysis of Guglielmi and Werner. In contrast, levels of 27SA3 pre-rRNAs are decreased 2-fold in rich medium and 6-fold in minimal medium in Δgno1 compared to wild-type cells as assessed by primer extension analyses (Figure 4B). In addition, steady-state levels of the 27SB pre-rRNAs are decreased 3-fold in rich medium and 4.6-fold in minimal medium in Δgno1 compared to wild-type cells (Figure 4A). Moreover, levels of 7SL and 7SS pre-rRNAs are diminished 2.4-fold in rich medium and 3.5-fold in minimal medium, arguing that lack of Gno1p impairs the production and/or stability of both the long and short forms of 27SB. Primer extension analyses that detect pre-rRNA species, the 5′ end of which extends to sites B1S, B1L and A2 (Supplementary Figure S3), are fully consistent with the northern data (Figure 4A). We conclude that Gno1p is required for the normal accumulation, and likely the normal production, of both pre-40S particles and intermediate nuclear pre-60S particles containing the 27SA3 or the 27SBL pre-rRNA.


The telomerase inhibitor Gno1p/PINX1 activates the helicase Prp43p during ribosome biogenesis.

Chen YL, Capeyrou R, Humbert O, Mouffok S, Kadri YA, Lebaron S, Henras AK, Henry Y - Nucleic Acids Res. (2014)

Analysis of pre-rRNA processing in Δgno1 cells. (A) Northern blot analysis of various (pre)-rRNAs extracted from WT or Δgno1 cells. RNAs were extracted from WT (lanes 1 and 3) or Δgno1 (lanes 2 and 4) cells grown in YPGlu (lanes 1 and 2) or YNBGlu (lanes 3 and 4) media, separated on a 1.2% agarose gel in denaturing conditions, transferred to a nylon membrane and detected using various specific oligonucleotide probes. (B) Primer extension analysis of 27SA3 pre-rRNAs. Primer extensions were carried out using RNAs extracted from WT or Δgno1 cells grown in YPGlu or YNBGlu media as indicated and a kinased primer hybridizing at the 3′ end of internal transcribed spacer 1 (5′TTAATATTTTAAAATTTCCAGTTACGAAAATTC3′). The sequencing ladder was generated using the same kinased primer. (C) Pulse-chase analysis. WT and Δgno1 cells grown at 30°C in YNBGlu medium were incubated for 2 min with 3H-adenine. An excess of cold adenine was then added to the cultures and culture samples were collected at the indicated times after cold adenine addition. Total RNAs were extracted from these samples, separated on a 1.2% agarose gel in denaturing conditions and transferred to a nylon membrane. Labeled RNAs were directly detected by autoradiography.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4066782&req=5

Figure 4: Analysis of pre-rRNA processing in Δgno1 cells. (A) Northern blot analysis of various (pre)-rRNAs extracted from WT or Δgno1 cells. RNAs were extracted from WT (lanes 1 and 3) or Δgno1 (lanes 2 and 4) cells grown in YPGlu (lanes 1 and 2) or YNBGlu (lanes 3 and 4) media, separated on a 1.2% agarose gel in denaturing conditions, transferred to a nylon membrane and detected using various specific oligonucleotide probes. (B) Primer extension analysis of 27SA3 pre-rRNAs. Primer extensions were carried out using RNAs extracted from WT or Δgno1 cells grown in YPGlu or YNBGlu media as indicated and a kinased primer hybridizing at the 3′ end of internal transcribed spacer 1 (5′TTAATATTTTAAAATTTCCAGTTACGAAAATTC3′). The sequencing ladder was generated using the same kinased primer. (C) Pulse-chase analysis. WT and Δgno1 cells grown at 30°C in YNBGlu medium were incubated for 2 min with 3H-adenine. An excess of cold adenine was then added to the cultures and culture samples were collected at the indicated times after cold adenine addition. Total RNAs were extracted from these samples, separated on a 1.2% agarose gel in denaturing conditions and transferred to a nylon membrane. Labeled RNAs were directly detected by autoradiography.
Mentions: Guglielmi and Werner have previously reported (29) increased steady-state levels of 35S pre-rRNA and impaired cleavages at the A0, A1 and A2 sites in Δgno1 cells, resulting in lower 20S pre-rRNA accumulation (see Supplementary Figure S2 for a cartoon of pre-rRNA processing in yeast cells). They did not mention however a defect in the pre-60S pathway, except for a decrease in 27SA2 pre-rRNA levels as assessed by primer extension. We therefore carried out our own northern blot assessment of the relative accumulation levels of various pre-rRNA intermediates in Δgno1 compared to wild-type cells (Figure 4A). As observed by Guglielmi and Werner, we detect an accumulation of the 35S pre-rRNA and a decrease in the steady-state levels of 20S pre-rRNA. There is also a very slight accumulation of the 33/32S pre-rRNAs. 23S pre-rRNA is increased when the Δgno1 strain is grown in rich medium but not when it is grown in selective minimal medium. 27SA2 pre-rRNA levels are not diminished. The same conclusion can in fact be drawn from the northern analysis of Guglielmi and Werner. In contrast, levels of 27SA3 pre-rRNAs are decreased 2-fold in rich medium and 6-fold in minimal medium in Δgno1 compared to wild-type cells as assessed by primer extension analyses (Figure 4B). In addition, steady-state levels of the 27SB pre-rRNAs are decreased 3-fold in rich medium and 4.6-fold in minimal medium in Δgno1 compared to wild-type cells (Figure 4A). Moreover, levels of 7SL and 7SS pre-rRNAs are diminished 2.4-fold in rich medium and 3.5-fold in minimal medium, arguing that lack of Gno1p impairs the production and/or stability of both the long and short forms of 27SB. Primer extension analyses that detect pre-rRNA species, the 5′ end of which extends to sites B1S, B1L and A2 (Supplementary Figure S3), are fully consistent with the northern data (Figure 4A). We conclude that Gno1p is required for the normal accumulation, and likely the normal production, of both pre-40S particles and intermediate nuclear pre-60S particles containing the 27SA3 or the 27SBL pre-rRNA.

Bottom Line: In yeast, lack of Gno1p leads to a decrease in the levels of pre-40S and intermediate pre-60S pre-ribosomal particles, defects that can be corrected by PINX1 expression.G-patch alterations in Gno1p or PINX1 that inhibit their interactions with Prp43p completely abolish their function in yeast ribosome biogenesis.Altogether, our results suggest that activation of Prp43p by Gno1p/PINX1 within early pre-ribosomal particles is crucial for their subsequent maturation.

View Article: PubMed Central - PubMed

Affiliation: Equipe labellisée Ligue Contre le Cancer, LBME, CNRS and Toulouse University, Toulouse 31062, France.

Show MeSH