Limits...
Amplified voltammetric detection of glycoproteins using 4-mercaptophenylboronic acid/biotin-modified multifunctional gold nanoparticles as labels.

Liu L, Xing Y, Zhang H, Liu R, Liu H, Xia N - Int J Nanomedicine (2014)

Bottom Line: The MBA-biotin-AuNPs facilitated the attachment of streptavidin-conjugated alkaline phosphatase for the production of electroactive p-aminophenol from p-aminophenyl phosphate substrate.A detection limit of 8 fmol L(-1) for rHuEPO detection was achieved.Other glycosylated and non-glycosylated proteins, such as horseradish peroxidase, prostate specific antigen, metallothionein, streptavidin, and thrombin showed no interference in the detection assay.

View Article: PubMed Central - PubMed

Affiliation: College of Chemistry and Chemical Engineering, Anyang Normal University, Anyang, Henan, People's Republic of China ; College of Chemistry and Chemical Engineering, Central South University, Changsha, Hunan, People's Republic of China.

ABSTRACT
Ultrasensitive detection of protein biomarkers is essential for early diagnosis and therapy of many diseases. Glycoproteins, differing from other types of proteins, contain carbohydrate moieties in the oligosaccharide chains. Boronic acid can form boronate ester covalent bonds with diol-containing species. Herein, we present a sensitive and cost-effective electrochemical method for glycoprotein detection using 4-mercaptophenylboronic acid (MBA)/biotin-modified gold nanoparticles (AuNPs) (MBA-biotin-AuNPs) as labels. To demonstrate the feasibility and sensitivity of this method, recombinant human erythropoietin (rHuEPO) was tested as a model analyte. Specifically, rHuEPO was captured by the anti-rHuEPO aptamer-covered electrode and then derivatized with MBA-biotin-AuNPs through the boronic acid-carbohydrate interaction. The MBA-biotin-AuNPs facilitated the attachment of streptavidin-conjugated alkaline phosphatase for the production of electroactive p-aminophenol from p-aminophenyl phosphate substrate. A detection limit of 8 fmol L(-1) for rHuEPO detection was achieved. Other glycosylated and non-glycosylated proteins, such as horseradish peroxidase, prostate specific antigen, metallothionein, streptavidin, and thrombin showed no interference in the detection assay.

Show MeSH

Related in: MedlinePlus

Schematic illustration of the method for rHuEOP detection by MBA-biotin-AuNPs as labels.Abbreviations: BSA, bovine serum albumin; MBA-biotin-AuNP, 4-mercaptophenylboronic acid/biotin-modified gold nanoparticle; MCH, 6-mercapto-1-hexanol; p-AP, p-aminophenol; p-APP, p-aminophenyl phosphate; rHUEPO, recombinant human erythropoietin; SA-ALP, streptavidin-conjugated alkaline phosphatase.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC4043723&req=5

f1-ijn-9-2619: Schematic illustration of the method for rHuEOP detection by MBA-biotin-AuNPs as labels.Abbreviations: BSA, bovine serum albumin; MBA-biotin-AuNP, 4-mercaptophenylboronic acid/biotin-modified gold nanoparticle; MCH, 6-mercapto-1-hexanol; p-AP, p-aminophenol; p-APP, p-aminophenyl phosphate; rHUEPO, recombinant human erythropoietin; SA-ALP, streptavidin-conjugated alkaline phosphatase.

Mentions: Aptamers, small strands of DNA or RNA (ribonucleic acid), can specifically bind to targets with high affinity.29 In comparison with antibodies, aptamers possess distinctive several advantages such as small sizes, high stability, ease of synthesis, and a lack of immunogenicity. This allows aptamers to be the most valuable molecular acceptors for the capture and recognition of biomolecules. Furthermore, antibodies will be unsuitable for the present system since they contain carbohydrate moieties in the oligosaccharide chains. Thus, aptamers were used as the acceptors for the capture of glycoproteins in this work. rHuEPO is a glycoprotein hormone that has been used extensively for the treatment of several anemias associated with acute and chronic diseases, by stimulating red blood cell production. To demonstrate the feasibility of our method for glycoprotein detection, rHuEPO was tested. The principle of the method is presented in Figure 1. First, rHuEPO was captured by the anti-rHuEPO aptamer-covered gold electrode. Among the published anti-rHuEPO aptamers, the 39-base oligonucleotide (GATT GAAAGGTCTGTTTTTGGGGTTGGTTTGGGTCAATA) binds to rHuEPO with the highest affinity.30–33 The captured rHuEOP molecules were then derivatized with MBA-biotin-AuNPs through the boronic acid–carbohydrate interaction, which facilitated the attachment of SA-ALP. Finally, the p-AP produced from p-APP substrate was detected electrochemically.34 This method would be very sensitive, since one rHuEPO molecule can capture more than one MBA-biotin-AuNP, and each MBA-biotin-AuNP can load more than one SA-ALP molecule.


Amplified voltammetric detection of glycoproteins using 4-mercaptophenylboronic acid/biotin-modified multifunctional gold nanoparticles as labels.

Liu L, Xing Y, Zhang H, Liu R, Liu H, Xia N - Int J Nanomedicine (2014)

Schematic illustration of the method for rHuEOP detection by MBA-biotin-AuNPs as labels.Abbreviations: BSA, bovine serum albumin; MBA-biotin-AuNP, 4-mercaptophenylboronic acid/biotin-modified gold nanoparticle; MCH, 6-mercapto-1-hexanol; p-AP, p-aminophenol; p-APP, p-aminophenyl phosphate; rHUEPO, recombinant human erythropoietin; SA-ALP, streptavidin-conjugated alkaline phosphatase.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC4043723&req=5

f1-ijn-9-2619: Schematic illustration of the method for rHuEOP detection by MBA-biotin-AuNPs as labels.Abbreviations: BSA, bovine serum albumin; MBA-biotin-AuNP, 4-mercaptophenylboronic acid/biotin-modified gold nanoparticle; MCH, 6-mercapto-1-hexanol; p-AP, p-aminophenol; p-APP, p-aminophenyl phosphate; rHUEPO, recombinant human erythropoietin; SA-ALP, streptavidin-conjugated alkaline phosphatase.
Mentions: Aptamers, small strands of DNA or RNA (ribonucleic acid), can specifically bind to targets with high affinity.29 In comparison with antibodies, aptamers possess distinctive several advantages such as small sizes, high stability, ease of synthesis, and a lack of immunogenicity. This allows aptamers to be the most valuable molecular acceptors for the capture and recognition of biomolecules. Furthermore, antibodies will be unsuitable for the present system since they contain carbohydrate moieties in the oligosaccharide chains. Thus, aptamers were used as the acceptors for the capture of glycoproteins in this work. rHuEPO is a glycoprotein hormone that has been used extensively for the treatment of several anemias associated with acute and chronic diseases, by stimulating red blood cell production. To demonstrate the feasibility of our method for glycoprotein detection, rHuEPO was tested. The principle of the method is presented in Figure 1. First, rHuEPO was captured by the anti-rHuEPO aptamer-covered gold electrode. Among the published anti-rHuEPO aptamers, the 39-base oligonucleotide (GATT GAAAGGTCTGTTTTTGGGGTTGGTTTGGGTCAATA) binds to rHuEPO with the highest affinity.30–33 The captured rHuEOP molecules were then derivatized with MBA-biotin-AuNPs through the boronic acid–carbohydrate interaction, which facilitated the attachment of SA-ALP. Finally, the p-AP produced from p-APP substrate was detected electrochemically.34 This method would be very sensitive, since one rHuEPO molecule can capture more than one MBA-biotin-AuNP, and each MBA-biotin-AuNP can load more than one SA-ALP molecule.

Bottom Line: The MBA-biotin-AuNPs facilitated the attachment of streptavidin-conjugated alkaline phosphatase for the production of electroactive p-aminophenol from p-aminophenyl phosphate substrate.A detection limit of 8 fmol L(-1) for rHuEPO detection was achieved.Other glycosylated and non-glycosylated proteins, such as horseradish peroxidase, prostate specific antigen, metallothionein, streptavidin, and thrombin showed no interference in the detection assay.

View Article: PubMed Central - PubMed

Affiliation: College of Chemistry and Chemical Engineering, Anyang Normal University, Anyang, Henan, People's Republic of China ; College of Chemistry and Chemical Engineering, Central South University, Changsha, Hunan, People's Republic of China.

ABSTRACT
Ultrasensitive detection of protein biomarkers is essential for early diagnosis and therapy of many diseases. Glycoproteins, differing from other types of proteins, contain carbohydrate moieties in the oligosaccharide chains. Boronic acid can form boronate ester covalent bonds with diol-containing species. Herein, we present a sensitive and cost-effective electrochemical method for glycoprotein detection using 4-mercaptophenylboronic acid (MBA)/biotin-modified gold nanoparticles (AuNPs) (MBA-biotin-AuNPs) as labels. To demonstrate the feasibility and sensitivity of this method, recombinant human erythropoietin (rHuEPO) was tested as a model analyte. Specifically, rHuEPO was captured by the anti-rHuEPO aptamer-covered electrode and then derivatized with MBA-biotin-AuNPs through the boronic acid-carbohydrate interaction. The MBA-biotin-AuNPs facilitated the attachment of streptavidin-conjugated alkaline phosphatase for the production of electroactive p-aminophenol from p-aminophenyl phosphate substrate. A detection limit of 8 fmol L(-1) for rHuEPO detection was achieved. Other glycosylated and non-glycosylated proteins, such as horseradish peroxidase, prostate specific antigen, metallothionein, streptavidin, and thrombin showed no interference in the detection assay.

Show MeSH
Related in: MedlinePlus