Limits...
A Novel Homozygous Nucleotide Deletion in the JAK2 Gene in a Pediatric Patient with B-cell Precursor Acute Lymphoblastic Leukemia.

Akın DF, Akkaya E, Kürekçi AE, Arslan C, Ezer U, Akar N - Turk J Haematol (2012)

View Article: PubMed Central - PubMed

Affiliation: LOSEV Foundation for Children with Leukemia, Ankara, Turkey.

AUTOMATICALLY GENERATED EXCERPT
Please rate it.

Janus kinase 2 (JAK2) is a protein tyrosine kinase that transduces cellular signals through the Janus kinase signal transducer and an activator of transcription pathways (JAK-STAT), which mediates cell growth, differentiation, apoptosis, transformation, and other fundamental cell functions, and is active in both normal hematopoiesis and hematological malignancies... Herein, we report a novel homozygous “G” deletion at exon 12 of the JAK2 gene in a pediatric patient with acute lymphoblastic leukemia (ALL)... All sequencing reactions were performed twice, using 2 different PCR products... Sequencing of the exon at admission showed that a homozygous “G” deletion at nt 2078 (in genomic seq./nt 1584 in c-DNA seq.) resulted in substitution of arginine (AGG) with serine (AGC) in codon 528 (Figures 1 and 2) (ref Seq; ENSG00000096968)... The observed substitution was a novel change... We did not observe “G” deletion in the patient during remission or in his mother... A Western blot showing a truncated protein would have significantly strengthened our report; however, serum sample at admission was unavailable... Although it was reported that JAK2 V617F mutation is absent in childhood ALL, rare mutations have been reported, especially in Down syndrome patients with acute leukemia... A 5-base deletion in the region was first reported in a Down syndrome patient associated with B-cell precursor ALL... Moreover it was recently reported that CRLF2 gene rearrangements were strongly associated with JAK2 mutations... The diagnosis of B-cell precursor ALL in the presented case warrants comprehensive mutational screening of the entire JAK2 gene coding exon in patients with this type of ALL.

No MeSH data available.


Sequencing analysis of exon 12 of the JAK2 gene in the presented case while in remission.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3986960&req=5

f2: Sequencing analysis of exon 12 of the JAK2 gene in the presented case while in remission.

Mentions: Blood samples were obtained from the patient and his mother at admission and remission, and the phenolchloroform method was used to extract DNA. Written informed consent was obtained from the parents of patient. Using primers f5’CTCCTCTTTGGAGCAATTCA3’ and r5’TATCGCAACTCCCAAGTTCTC3’ we amplified and sequenced exon 12 of the JAK2 gene (Beckman Coulter, USA). All sequencing reactions were performed twice, using 2 different PCR products. Sequencing of the exon at admission showed that a homozygous “G” deletion at nt 2078 (in genomic seq./nt 1584 in c-DNA seq.) resulted in substitution of arginine (AGG) with serine (AGC) in codon 528 (Figures 1 and 2) (ref Seq; ENSG00000096968). In all, we scanned 14 patients with ALL.


A Novel Homozygous Nucleotide Deletion in the JAK2 Gene in a Pediatric Patient with B-cell Precursor Acute Lymphoblastic Leukemia.

Akın DF, Akkaya E, Kürekçi AE, Arslan C, Ezer U, Akar N - Turk J Haematol (2012)

Sequencing analysis of exon 12 of the JAK2 gene in the presented case while in remission.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3986960&req=5

f2: Sequencing analysis of exon 12 of the JAK2 gene in the presented case while in remission.
Mentions: Blood samples were obtained from the patient and his mother at admission and remission, and the phenolchloroform method was used to extract DNA. Written informed consent was obtained from the parents of patient. Using primers f5’CTCCTCTTTGGAGCAATTCA3’ and r5’TATCGCAACTCCCAAGTTCTC3’ we amplified and sequenced exon 12 of the JAK2 gene (Beckman Coulter, USA). All sequencing reactions were performed twice, using 2 different PCR products. Sequencing of the exon at admission showed that a homozygous “G” deletion at nt 2078 (in genomic seq./nt 1584 in c-DNA seq.) resulted in substitution of arginine (AGG) with serine (AGC) in codon 528 (Figures 1 and 2) (ref Seq; ENSG00000096968). In all, we scanned 14 patients with ALL.

View Article: PubMed Central - PubMed

Affiliation: LOSEV Foundation for Children with Leukemia, Ankara, Turkey.

AUTOMATICALLY GENERATED EXCERPT
Please rate it.

Janus kinase 2 (JAK2) is a protein tyrosine kinase that transduces cellular signals through the Janus kinase signal transducer and an activator of transcription pathways (JAK-STAT), which mediates cell growth, differentiation, apoptosis, transformation, and other fundamental cell functions, and is active in both normal hematopoiesis and hematological malignancies... Herein, we report a novel homozygous “G” deletion at exon 12 of the JAK2 gene in a pediatric patient with acute lymphoblastic leukemia (ALL)... All sequencing reactions were performed twice, using 2 different PCR products... Sequencing of the exon at admission showed that a homozygous “G” deletion at nt 2078 (in genomic seq./nt 1584 in c-DNA seq.) resulted in substitution of arginine (AGG) with serine (AGC) in codon 528 (Figures 1 and 2) (ref Seq; ENSG00000096968)... The observed substitution was a novel change... We did not observe “G” deletion in the patient during remission or in his mother... A Western blot showing a truncated protein would have significantly strengthened our report; however, serum sample at admission was unavailable... Although it was reported that JAK2 V617F mutation is absent in childhood ALL, rare mutations have been reported, especially in Down syndrome patients with acute leukemia... A 5-base deletion in the region was first reported in a Down syndrome patient associated with B-cell precursor ALL... Moreover it was recently reported that CRLF2 gene rearrangements were strongly associated with JAK2 mutations... The diagnosis of B-cell precursor ALL in the presented case warrants comprehensive mutational screening of the entire JAK2 gene coding exon in patients with this type of ALL.

No MeSH data available.