Limits...
Age-related changes in the contractile and passive arterial properties of murine mesenteric small arteries are altered by caveolin-1 knockout.

Hausman N, Martin J, Taggart MJ, Austin C - J. Cell. Mol. Med. (2012)

Bottom Line: Caveolin-1, an integral protein of caveolae, is associated with multiple cardiovascular signalling pathways.As changes in artery structure and function are associated with ageing we have investigated the role of caveolin-1 ablation on age-related changes of small artery contractility and passive mechanical properties.Caveolin-1 ablation at 3 months of age resulted in similar changes in passive arterial properties to those observed with ageing in WT animals.

View Article: PubMed Central - PubMed

Affiliation: Cardiovascular Research Group, University of Manchester, Manchester, UK.

Show MeSH

Related in: MedlinePlus

Determination of caveolin-1 knockout and wild-type genotype. Agarose gel electrophoresis of mouse PCR products of reactions using caveolin-1 knockout (A) or wild-type (B) primers. Samples positive only for knockout primers (red circles) were knockout mice (KO) and those positive only for wild-type primers (blue circles) were wild-type (W) mice. Samples positive for both primer sets were from heterozygous mice (H). (C) Western blotting of tissues with anti-caveolin-1 antibody confirmed ablation of caveolin-1 from KO mice.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC3822685&req=5

fig01: Determination of caveolin-1 knockout and wild-type genotype. Agarose gel electrophoresis of mouse PCR products of reactions using caveolin-1 knockout (A) or wild-type (B) primers. Samples positive only for knockout primers (red circles) were knockout mice (KO) and those positive only for wild-type primers (blue circles) were wild-type (W) mice. Samples positive for both primer sets were from heterozygous mice (H). (C) Western blotting of tissues with anti-caveolin-1 antibody confirmed ablation of caveolin-1 from KO mice.

Mentions: DNA was extracted in lysis buffer (composition: 50 mM Tris pH8, 100 mM EDTA, 0.5% SDS, 10 mg/ml proteinase K; Promega, Southampton, UK) isopropanol precipitated, washed in ethanol and resuspended in distilled water. WT, heterozygous (Ht) or KO genotype was confirmed by PCR (Fig. 1) using primers specific for the WT (forward: TTTACCGCTTGTTGTCTACGA; reverse: TATCTCTTTCTGCGTGCTGA; product size 240bp) or KO genotype (forward: TATTCTGCCTTCCTGATGATAACTG; reverse: CCTGCGTGCAATCCATCTTGTTCAATG; product size 1500bp).


Age-related changes in the contractile and passive arterial properties of murine mesenteric small arteries are altered by caveolin-1 knockout.

Hausman N, Martin J, Taggart MJ, Austin C - J. Cell. Mol. Med. (2012)

Determination of caveolin-1 knockout and wild-type genotype. Agarose gel electrophoresis of mouse PCR products of reactions using caveolin-1 knockout (A) or wild-type (B) primers. Samples positive only for knockout primers (red circles) were knockout mice (KO) and those positive only for wild-type primers (blue circles) were wild-type (W) mice. Samples positive for both primer sets were from heterozygous mice (H). (C) Western blotting of tissues with anti-caveolin-1 antibody confirmed ablation of caveolin-1 from KO mice.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC3822685&req=5

fig01: Determination of caveolin-1 knockout and wild-type genotype. Agarose gel electrophoresis of mouse PCR products of reactions using caveolin-1 knockout (A) or wild-type (B) primers. Samples positive only for knockout primers (red circles) were knockout mice (KO) and those positive only for wild-type primers (blue circles) were wild-type (W) mice. Samples positive for both primer sets were from heterozygous mice (H). (C) Western blotting of tissues with anti-caveolin-1 antibody confirmed ablation of caveolin-1 from KO mice.
Mentions: DNA was extracted in lysis buffer (composition: 50 mM Tris pH8, 100 mM EDTA, 0.5% SDS, 10 mg/ml proteinase K; Promega, Southampton, UK) isopropanol precipitated, washed in ethanol and resuspended in distilled water. WT, heterozygous (Ht) or KO genotype was confirmed by PCR (Fig. 1) using primers specific for the WT (forward: TTTACCGCTTGTTGTCTACGA; reverse: TATCTCTTTCTGCGTGCTGA; product size 240bp) or KO genotype (forward: TATTCTGCCTTCCTGATGATAACTG; reverse: CCTGCGTGCAATCCATCTTGTTCAATG; product size 1500bp).

Bottom Line: Caveolin-1, an integral protein of caveolae, is associated with multiple cardiovascular signalling pathways.As changes in artery structure and function are associated with ageing we have investigated the role of caveolin-1 ablation on age-related changes of small artery contractility and passive mechanical properties.Caveolin-1 ablation at 3 months of age resulted in similar changes in passive arterial properties to those observed with ageing in WT animals.

View Article: PubMed Central - PubMed

Affiliation: Cardiovascular Research Group, University of Manchester, Manchester, UK.

Show MeSH
Related in: MedlinePlus