Limits...
Evaluation of DNA extraction from granulocytes discarded in the separation medium after isolation of peripheral blood mononuclear cells and plasma from whole blood.

Murray JR, Rajeevan MS - BMC Res Notes (2013)

Bottom Line: Whole blood is generally processed for plasma and peripheral blood mononuclear cells (PBMCs) from granulocytes/erythrocytes using gradient centrifugation of blood with Histopaue-Ficoll.The quality of isolated DNA was sufficient for use as a template for restriction enzyme digestion, real-time PCR, pyrosequencing, and gel based variable number tandem repeats (VNTR) genotyping.By demonstrating the extraction of substantial amounts of high quality granulocytes DNA without purifying them from the separation medium, this method offers laboratories and biobanks a flexible and cost-effective approach to obtain plasma, PBMCs, and large amounts of DNA from a single blood collection for a variety of molecular genetics/epidemiologic studies.

View Article: PubMed Central - HTML - PubMed

Affiliation: Division of High-Consequence Pathogens and Pathology, Centers for Disease Control & Prevention, 1600 Clifton Rd Mailstop G41, Atlanta, GA 30333, USA. mor4@cdc.gov.

ABSTRACT

Background: Whole blood is generally processed for plasma and peripheral blood mononuclear cells (PBMCs) from granulocytes/erythrocytes using gradient centrifugation of blood with Histopaue-Ficoll. After separation of plasma and PBMCs, the residual erythrocytes/granulocytes, a rich source of DNA, is often discarded along with the separation medium. In order to isolate DNA from the granulocytes, current methods require the removal of the separation medium and subsequent purification of granulocytes. This report provides a method for extracting DNA using the PAXgene Blood DNA kit from granulocytes without purifying them from the separation medium.

Findings: Based on 719 erythrocyte/granulocyte samples stored frozen for approximately 10 years in Ficoll-Hypaque separation medium, the mean yield of DNA was 395 μg (median = 281 μg; range = 1.36 to 2077.2 μg), with mean A260/A280 ratio of 1.84 (median = 1.84; range = 1.17 to 2.23). The quality of isolated DNA was sufficient for use as a template for restriction enzyme digestion, real-time PCR, pyrosequencing, and gel based variable number tandem repeats (VNTR) genotyping.

Conclusions: By demonstrating the extraction of substantial amounts of high quality granulocytes DNA without purifying them from the separation medium, this method offers laboratories and biobanks a flexible and cost-effective approach to obtain plasma, PBMCs, and large amounts of DNA from a single blood collection for a variety of molecular genetics/epidemiologic studies.

Show MeSH

Related in: MedlinePlus

Evaluation of granulocytes DNA extracted with separation medium after isolation of plasma and PBMCs. (A) A 0.8% agarose gel stained with ethidium bromide demonstrating high molecular weight DNA, and its near complete digestion with EcoRV and BamH1. Lanes 1 and 24 represent the Lambda DNA/HindIII Marker. Lanes 2–21 are a side by side comparison of the digested and undigested granulocyte DNA extracted with separation medium from 10 subjects. Lanes 22–23 represent digested and undigested whole blood DNA for comparison with granulocyte DNA. (B) A typical performance of granulocyte DNA extracted with separation medium in real-time PCR for the 36B4 single copy gene (representative standard curve on the left and melting curves on the right); (C) A representative pyrogram for SNP rs6112 using granulocyte DNA extracted with separation medium for successful genotyping; (D) Gel-based VNTR analysis of the CCR5 VNTR on granulocyte DNA extracted with separation medium and whole blood DNA. Lanes 1 and 15 represent the 50–2,000 bp markers. Lanes 2–11 represent the granulocyte DNAs extracted with separation medium. Lane 12 represents the whole blood DNA and lanes 13 and 14 contain negative water controls. Arrows indicate expected product sizes (189 bp, and 157 bp) for this VNTR.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3818442&req=5

Figure 2: Evaluation of granulocytes DNA extracted with separation medium after isolation of plasma and PBMCs. (A) A 0.8% agarose gel stained with ethidium bromide demonstrating high molecular weight DNA, and its near complete digestion with EcoRV and BamH1. Lanes 1 and 24 represent the Lambda DNA/HindIII Marker. Lanes 2–21 are a side by side comparison of the digested and undigested granulocyte DNA extracted with separation medium from 10 subjects. Lanes 22–23 represent digested and undigested whole blood DNA for comparison with granulocyte DNA. (B) A typical performance of granulocyte DNA extracted with separation medium in real-time PCR for the 36B4 single copy gene (representative standard curve on the left and melting curves on the right); (C) A representative pyrogram for SNP rs6112 using granulocyte DNA extracted with separation medium for successful genotyping; (D) Gel-based VNTR analysis of the CCR5 VNTR on granulocyte DNA extracted with separation medium and whole blood DNA. Lanes 1 and 15 represent the 50–2,000 bp markers. Lanes 2–11 represent the granulocyte DNAs extracted with separation medium. Lane 12 represents the whole blood DNA and lanes 13 and 14 contain negative water controls. Arrows indicate expected product sizes (189 bp, and 157 bp) for this VNTR.

Mentions: In this study, we extracted DNA directly from a total of 719 residual erythrocytes/granulocytes in separation medium after the isolation of plasma and PBMC. The average A260/A280 ratio was 1.84 (range 1.17 to 2.23; median 1.84) with 99% of the samples being good quality based on A260/A280 ratio between 1.7 and 2.0. The average yield was 395 μg (range 1.36 to 2077.2 μg; median 281 μg) with 95% of samples yielding >50 μg DNA per sample. Samples yielded high molecular weight DNA as indicated by electrophoresis in 0.8% agarose gel and ethidium bromide stain (Figure 2A). We evaluated 10 DNA samples extracted from granulocytes with separation medium for their suitability for restriction enzyme digestion, real time PCR, pyrosequencing, and VNTR genotyping. DNA from a whole blood sample extracted by the same method was included as a control for these evaluations. We observed a nearly complete digestion of DNA (500 ng) in a 50 μl reaction containing 50 U each of EcoRV and BamHI enzymes (New England Biolabs, Ipswich, MA, USA) and incubated at 37°C for 16 hours (Figure 2A). Granulocyte DNA extracted with separation medium was subjected to LightCycler 480 and SYBR Green dye I (Roche Applied Science, Indianapolis, IN USA) based real time PCR for the amplification of 36B4 (also known as RPLPO) gene using previously published primer sequences [12]. Granulocyte DNA amplified with efficiency (PCR efficiency 1.88) similar to the control whole blood DNA (PCR efficiency 1.89) extracted by the same protocol (Figure 2B). The suitability of granulocyte DNA extracted with separation medium for pyrosequencing was tested by genotyping single nucleotide polymorphism (SNP) rs6112 located in the gene SERPINA5. We designed PCR (forward: ACGCTGTACCTGGCAGACACTT and reverse: CGAGGTTCTTAAGCAAGTCCACAA) and sequencing primers (CCTGGCAGACACTTTC) for rs6112 using the Assay Design Software (Qiagen). Pyrosequencing was done with PyroMark PCR Kit (Qiagen) and PSQ 96 MD (Qiagen) following the manufacturer’s instruction. Granulocyte DNA from all 10 samples yielded unambiguous pyrograms and passed automatic genotype calling for rs6112 (Figure 2C). A gel-based assay was used for genotyping of the chemokine receptor 5 (CCR5) VNTR using the PyroMark PCR kit (Qiagen) [13]. PCR bands of expected sizes (157 bp and 189 bp) were seen with all samples (Figure 2D). From these successful results with a variety of enzymatic assays, granulocyte DNA extracted with the separation medium is expected to work equally well with other molecular genetics assays designed to determine copy number variation, methylation status, etc.


Evaluation of DNA extraction from granulocytes discarded in the separation medium after isolation of peripheral blood mononuclear cells and plasma from whole blood.

Murray JR, Rajeevan MS - BMC Res Notes (2013)

Evaluation of granulocytes DNA extracted with separation medium after isolation of plasma and PBMCs. (A) A 0.8% agarose gel stained with ethidium bromide demonstrating high molecular weight DNA, and its near complete digestion with EcoRV and BamH1. Lanes 1 and 24 represent the Lambda DNA/HindIII Marker. Lanes 2–21 are a side by side comparison of the digested and undigested granulocyte DNA extracted with separation medium from 10 subjects. Lanes 22–23 represent digested and undigested whole blood DNA for comparison with granulocyte DNA. (B) A typical performance of granulocyte DNA extracted with separation medium in real-time PCR for the 36B4 single copy gene (representative standard curve on the left and melting curves on the right); (C) A representative pyrogram for SNP rs6112 using granulocyte DNA extracted with separation medium for successful genotyping; (D) Gel-based VNTR analysis of the CCR5 VNTR on granulocyte DNA extracted with separation medium and whole blood DNA. Lanes 1 and 15 represent the 50–2,000 bp markers. Lanes 2–11 represent the granulocyte DNAs extracted with separation medium. Lane 12 represents the whole blood DNA and lanes 13 and 14 contain negative water controls. Arrows indicate expected product sizes (189 bp, and 157 bp) for this VNTR.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3818442&req=5

Figure 2: Evaluation of granulocytes DNA extracted with separation medium after isolation of plasma and PBMCs. (A) A 0.8% agarose gel stained with ethidium bromide demonstrating high molecular weight DNA, and its near complete digestion with EcoRV and BamH1. Lanes 1 and 24 represent the Lambda DNA/HindIII Marker. Lanes 2–21 are a side by side comparison of the digested and undigested granulocyte DNA extracted with separation medium from 10 subjects. Lanes 22–23 represent digested and undigested whole blood DNA for comparison with granulocyte DNA. (B) A typical performance of granulocyte DNA extracted with separation medium in real-time PCR for the 36B4 single copy gene (representative standard curve on the left and melting curves on the right); (C) A representative pyrogram for SNP rs6112 using granulocyte DNA extracted with separation medium for successful genotyping; (D) Gel-based VNTR analysis of the CCR5 VNTR on granulocyte DNA extracted with separation medium and whole blood DNA. Lanes 1 and 15 represent the 50–2,000 bp markers. Lanes 2–11 represent the granulocyte DNAs extracted with separation medium. Lane 12 represents the whole blood DNA and lanes 13 and 14 contain negative water controls. Arrows indicate expected product sizes (189 bp, and 157 bp) for this VNTR.
Mentions: In this study, we extracted DNA directly from a total of 719 residual erythrocytes/granulocytes in separation medium after the isolation of plasma and PBMC. The average A260/A280 ratio was 1.84 (range 1.17 to 2.23; median 1.84) with 99% of the samples being good quality based on A260/A280 ratio between 1.7 and 2.0. The average yield was 395 μg (range 1.36 to 2077.2 μg; median 281 μg) with 95% of samples yielding >50 μg DNA per sample. Samples yielded high molecular weight DNA as indicated by electrophoresis in 0.8% agarose gel and ethidium bromide stain (Figure 2A). We evaluated 10 DNA samples extracted from granulocytes with separation medium for their suitability for restriction enzyme digestion, real time PCR, pyrosequencing, and VNTR genotyping. DNA from a whole blood sample extracted by the same method was included as a control for these evaluations. We observed a nearly complete digestion of DNA (500 ng) in a 50 μl reaction containing 50 U each of EcoRV and BamHI enzymes (New England Biolabs, Ipswich, MA, USA) and incubated at 37°C for 16 hours (Figure 2A). Granulocyte DNA extracted with separation medium was subjected to LightCycler 480 and SYBR Green dye I (Roche Applied Science, Indianapolis, IN USA) based real time PCR for the amplification of 36B4 (also known as RPLPO) gene using previously published primer sequences [12]. Granulocyte DNA amplified with efficiency (PCR efficiency 1.88) similar to the control whole blood DNA (PCR efficiency 1.89) extracted by the same protocol (Figure 2B). The suitability of granulocyte DNA extracted with separation medium for pyrosequencing was tested by genotyping single nucleotide polymorphism (SNP) rs6112 located in the gene SERPINA5. We designed PCR (forward: ACGCTGTACCTGGCAGACACTT and reverse: CGAGGTTCTTAAGCAAGTCCACAA) and sequencing primers (CCTGGCAGACACTTTC) for rs6112 using the Assay Design Software (Qiagen). Pyrosequencing was done with PyroMark PCR Kit (Qiagen) and PSQ 96 MD (Qiagen) following the manufacturer’s instruction. Granulocyte DNA from all 10 samples yielded unambiguous pyrograms and passed automatic genotype calling for rs6112 (Figure 2C). A gel-based assay was used for genotyping of the chemokine receptor 5 (CCR5) VNTR using the PyroMark PCR kit (Qiagen) [13]. PCR bands of expected sizes (157 bp and 189 bp) were seen with all samples (Figure 2D). From these successful results with a variety of enzymatic assays, granulocyte DNA extracted with the separation medium is expected to work equally well with other molecular genetics assays designed to determine copy number variation, methylation status, etc.

Bottom Line: Whole blood is generally processed for plasma and peripheral blood mononuclear cells (PBMCs) from granulocytes/erythrocytes using gradient centrifugation of blood with Histopaue-Ficoll.The quality of isolated DNA was sufficient for use as a template for restriction enzyme digestion, real-time PCR, pyrosequencing, and gel based variable number tandem repeats (VNTR) genotyping.By demonstrating the extraction of substantial amounts of high quality granulocytes DNA without purifying them from the separation medium, this method offers laboratories and biobanks a flexible and cost-effective approach to obtain plasma, PBMCs, and large amounts of DNA from a single blood collection for a variety of molecular genetics/epidemiologic studies.

View Article: PubMed Central - HTML - PubMed

Affiliation: Division of High-Consequence Pathogens and Pathology, Centers for Disease Control & Prevention, 1600 Clifton Rd Mailstop G41, Atlanta, GA 30333, USA. mor4@cdc.gov.

ABSTRACT

Background: Whole blood is generally processed for plasma and peripheral blood mononuclear cells (PBMCs) from granulocytes/erythrocytes using gradient centrifugation of blood with Histopaue-Ficoll. After separation of plasma and PBMCs, the residual erythrocytes/granulocytes, a rich source of DNA, is often discarded along with the separation medium. In order to isolate DNA from the granulocytes, current methods require the removal of the separation medium and subsequent purification of granulocytes. This report provides a method for extracting DNA using the PAXgene Blood DNA kit from granulocytes without purifying them from the separation medium.

Findings: Based on 719 erythrocyte/granulocyte samples stored frozen for approximately 10 years in Ficoll-Hypaque separation medium, the mean yield of DNA was 395 μg (median = 281 μg; range = 1.36 to 2077.2 μg), with mean A260/A280 ratio of 1.84 (median = 1.84; range = 1.17 to 2.23). The quality of isolated DNA was sufficient for use as a template for restriction enzyme digestion, real-time PCR, pyrosequencing, and gel based variable number tandem repeats (VNTR) genotyping.

Conclusions: By demonstrating the extraction of substantial amounts of high quality granulocytes DNA without purifying them from the separation medium, this method offers laboratories and biobanks a flexible and cost-effective approach to obtain plasma, PBMCs, and large amounts of DNA from a single blood collection for a variety of molecular genetics/epidemiologic studies.

Show MeSH
Related in: MedlinePlus