Limits...
Identification of a functional nuclear localization signal mediating nuclear import of the zinc finger transcription factor ZNF24.

Li JZ, Chen X, Gong XL, Hu HY, Shi D, Lu YM, Qiu L, Lu F, Hu ZL, Zhang JP - PLoS ONE (2013)

Bottom Line: Our results delimit the NLS to ZF1-2.ZNF24 containing histidine to leucine mutations that disrupt the structure of ZF1 or/and ZF2 retains appropriate nuclear localization, indicating that neither the tertiary structure of the zinc fingers nor specific DNA binding are necessary for nuclear localization.Taken together, these results suggest that consecutive ZF1-2 is critical for the regulation of ZNF24 nuclear localization and its transactivation function.

View Article: PubMed Central - PubMed

Affiliation: Department of Biochemical Pharmacy, Second Military Medical University, Shanghai, China.

ABSTRACT
ZNF24 is a member of the SCAN domain family of Krüppel-like zinc finger (ZF) transcription factors, which plays a critical role in cell proliferation and differentiation. However, how ZNF24 enters the nucleus in order to exert its function remains unclear since its nuclear localization signal(s) (NLS) has not been identified. Here, we generated a series of GFP-tagged deletion and point mutants and assessed their subcellular localization. Our results delimit the NLS to ZF1-2. Deletion of ZF1-2 caused cytoplasmic accumulation of ZNF24. Fusion of the ZF1-2 to green fluorescent protein (GFP) targeted GFP to the nucleus, demonstrating that the ZF1-2 is both necessary and sufficient for nuclear localization. ZNF24 containing histidine to leucine mutations that disrupt the structure of ZF1 or/and ZF2 retains appropriate nuclear localization, indicating that neither the tertiary structure of the zinc fingers nor specific DNA binding are necessary for nuclear localization. K286A and R290A mutation led to partial cytoplasmic accumulation. Co-immunoprecipitation demonstrated that ZNF24 interacted with importin-β and this interaction required the ZF motifs. The β-Catenin (CTNNB1) luciferase assays showed that the ZNF24 mutants defective in nuclear localization could not promote CTNNB1 promoter activation as the wild-type ZNF24 did. Taken together, these results suggest that consecutive ZF1-2 is critical for the regulation of ZNF24 nuclear localization and its transactivation function.

Show MeSH

Related in: MedlinePlus

ZNF24 DNA binding domain is necessary for nuclear localization in HEK293 cells.(A) Schematic of full-length and deletion ZNF24-GFP constructs used in this study (not to scale). The DNA binding domain is shown as four red boxes at the carboxyl terminus, with each box depicting a Krüppel-like zinc finger. All deletion constructs were fused to the N terminus of the GFP. (B) Protein localization of the ZNF24 constructs. HEK293 cells transfected with GFP control, pZNF24-GFP, p1-51-GFP, p1-200-GFP, p1-250-GFP, p161-250-GFP or p161-368-GFP. Digital images were taken by fluorescent microscopy. DAPI stain is shown to delineate nuclear boundaries (blue). Patterns of localization are summarized on the right by observing 100 transfected cells from 10 to 15 independent fields. N, exclusively nuclear; C, exclusively cytoplasmic; N=C, most cells show both nuclear and cytoplasmic localization with similar staining intensity in the nucleus and cytoplasm; N<C, most cells show both nuclear and cytoplasmic localization with brighter staining intensity in the cytoplasm; N>C, most cells show both nuclear and cytoplasmic localization with brighter staining intensity in the nucleus. (C) Results (mean±S.E.M., n=100) for quantitative analysis of images to determine the nuclear to cytoplasmic fluorescence ratio (Fn/c).
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC3815127&req=5

pone-0079910-g001: ZNF24 DNA binding domain is necessary for nuclear localization in HEK293 cells.(A) Schematic of full-length and deletion ZNF24-GFP constructs used in this study (not to scale). The DNA binding domain is shown as four red boxes at the carboxyl terminus, with each box depicting a Krüppel-like zinc finger. All deletion constructs were fused to the N terminus of the GFP. (B) Protein localization of the ZNF24 constructs. HEK293 cells transfected with GFP control, pZNF24-GFP, p1-51-GFP, p1-200-GFP, p1-250-GFP, p161-250-GFP or p161-368-GFP. Digital images were taken by fluorescent microscopy. DAPI stain is shown to delineate nuclear boundaries (blue). Patterns of localization are summarized on the right by observing 100 transfected cells from 10 to 15 independent fields. N, exclusively nuclear; C, exclusively cytoplasmic; N=C, most cells show both nuclear and cytoplasmic localization with similar staining intensity in the nucleus and cytoplasm; N<C, most cells show both nuclear and cytoplasmic localization with brighter staining intensity in the cytoplasm; N>C, most cells show both nuclear and cytoplasmic localization with brighter staining intensity in the nucleus. (C) Results (mean±S.E.M., n=100) for quantitative analysis of images to determine the nuclear to cytoplasmic fluorescence ratio (Fn/c).

Mentions: DNA encoding amino acids 1 to 51 (1 to 200, 1 to 250 and 161-250 ) and 161 to 368 of human ZNF24 were amplified by PCR using appropriate primers together with an upstream Kozak sequence, and the products were cloned into the Xho I/Sac II sites of pEGFP-N1 (Clontech) vector to produce p1-51-GFP (p1-200-GFP, p1-250-GFP and p161-250-GFP ) and p161-368-GFP, respectively(Figure 1A). Full-length human ZNF24 was amplified by PCR and was cloned into the Xho I/Sac II sites of pEGFP-N1 yielding pEGFP-ZNF24. The plasmid p1.5kb-Luc used for promoter reporter assays was made by polymerase chain reaction (PCR) from human genomic DNA, and subcloned into the Kpn I/Hind III sites of luciferase expression vector pGL3 basic (Promega). The primers are as follows: forward, 5’- ggaggtaccGACGGCAGTTGGCATTAC -3’; reverse, 5’-ggaaagcttGCTCCTCAGACCTTCCTCC-3’. The point mutations and internal deletions were carried out using site-directed mutagenesis by overlapping PCR. The primer pairs (forward/reverse) used to generate the point and internal deletion mutants are as follows. K258A: TGAATGTGGAGCACACTTCAGT/ ACTGAAGTGTGCTCCACATCA; S261A: AACACTTCGCTCAGGGCTCA/TG AGCCCTGAGCGAAGTGTT; S264A: AGAATTCACGCTGGGGAGAA/TTCTCC CCAGCGTGAATTCT; R271A: TCTTCATCAAGCAATTCACAGTG/CACTGTG AATTGCTTGATGAAGA; S274A: AGAATTCACGCTGGGGAGAAAC/GTT TCTCCCCAGCGTGAATTCT; K277A: ATTCACAGTGGGGAGGCACCTTATG GATGTGTT/AACACATCCATAAGGTGCCTCCCCACTGTGAAT; Y279A: GTG GGGAGAAACCTGCTGGATGTGTTGAGT/ACTCAACACATCCAGCAGGTTT CTCCCCAC;K286A: TGTGTTGAGTGTGGGGCAGCATTCAGCCGAAG/CTTC GGCTGAATGCTGCCCCACACTCAACACA; S289A: GAAAGCATTCGCCCGA AGTTCC/GGAACTTCGGGCGAATGCTTTC; R290A: GGAAAGCATTCAGCG CAAGTTCCATTCTTGTGC/GCACAAGAATGGAACTTGCGCTGAATGCTTTC C; S291A: TCAGCCGAGCTTCCATTCTT/AAGAATGGAAGCTCGGCTGA; S292A: AGCCGAAGTGCCATTCTTGTG/CACAAGAATGGCACTTCGGCT; R299A: CTTGTGCAACACCAGGCAGTCCACCCGCGGG/CCCGCGGGTGG ACTGCCTGGTGTTGCACA AG; H269/273L: CTTATTCTTCTTCAAAGAATT CTCAGTGGGGA/TCCCCACTGAGAATTCTTTGAAGAAGAATAAG; H297/ 301L: TGTGCAACTCCAGAGAGTCCTCACTGGAGA/TCTCCAGTGAGG ACT CTCTGGAGTTGCACA; dZF1-2: CTCTCGAAAGAAACAAACTGGAGA AAAACCTTA/TAAGGTTTTTCTCCAGTTTGTTTCTTTCGAGAG; dZF1: CTCTCGAAAGAAACAAAGTGGGGAGAAACCTT/AAGGTTTCTCCCCACTT TGTTTCTTTCGAGAG; dZF2: TCATCAAAGAATTCACACTGGAGAAAAACC TT/AAGGTTTTTCTCCAGTGTGAATTCTTTGATGA. The sequences of all constructs were confirmed by DNA sequencing.


Identification of a functional nuclear localization signal mediating nuclear import of the zinc finger transcription factor ZNF24.

Li JZ, Chen X, Gong XL, Hu HY, Shi D, Lu YM, Qiu L, Lu F, Hu ZL, Zhang JP - PLoS ONE (2013)

ZNF24 DNA binding domain is necessary for nuclear localization in HEK293 cells.(A) Schematic of full-length and deletion ZNF24-GFP constructs used in this study (not to scale). The DNA binding domain is shown as four red boxes at the carboxyl terminus, with each box depicting a Krüppel-like zinc finger. All deletion constructs were fused to the N terminus of the GFP. (B) Protein localization of the ZNF24 constructs. HEK293 cells transfected with GFP control, pZNF24-GFP, p1-51-GFP, p1-200-GFP, p1-250-GFP, p161-250-GFP or p161-368-GFP. Digital images were taken by fluorescent microscopy. DAPI stain is shown to delineate nuclear boundaries (blue). Patterns of localization are summarized on the right by observing 100 transfected cells from 10 to 15 independent fields. N, exclusively nuclear; C, exclusively cytoplasmic; N=C, most cells show both nuclear and cytoplasmic localization with similar staining intensity in the nucleus and cytoplasm; N<C, most cells show both nuclear and cytoplasmic localization with brighter staining intensity in the cytoplasm; N>C, most cells show both nuclear and cytoplasmic localization with brighter staining intensity in the nucleus. (C) Results (mean±S.E.M., n=100) for quantitative analysis of images to determine the nuclear to cytoplasmic fluorescence ratio (Fn/c).
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC3815127&req=5

pone-0079910-g001: ZNF24 DNA binding domain is necessary for nuclear localization in HEK293 cells.(A) Schematic of full-length and deletion ZNF24-GFP constructs used in this study (not to scale). The DNA binding domain is shown as four red boxes at the carboxyl terminus, with each box depicting a Krüppel-like zinc finger. All deletion constructs were fused to the N terminus of the GFP. (B) Protein localization of the ZNF24 constructs. HEK293 cells transfected with GFP control, pZNF24-GFP, p1-51-GFP, p1-200-GFP, p1-250-GFP, p161-250-GFP or p161-368-GFP. Digital images were taken by fluorescent microscopy. DAPI stain is shown to delineate nuclear boundaries (blue). Patterns of localization are summarized on the right by observing 100 transfected cells from 10 to 15 independent fields. N, exclusively nuclear; C, exclusively cytoplasmic; N=C, most cells show both nuclear and cytoplasmic localization with similar staining intensity in the nucleus and cytoplasm; N<C, most cells show both nuclear and cytoplasmic localization with brighter staining intensity in the cytoplasm; N>C, most cells show both nuclear and cytoplasmic localization with brighter staining intensity in the nucleus. (C) Results (mean±S.E.M., n=100) for quantitative analysis of images to determine the nuclear to cytoplasmic fluorescence ratio (Fn/c).
Mentions: DNA encoding amino acids 1 to 51 (1 to 200, 1 to 250 and 161-250 ) and 161 to 368 of human ZNF24 were amplified by PCR using appropriate primers together with an upstream Kozak sequence, and the products were cloned into the Xho I/Sac II sites of pEGFP-N1 (Clontech) vector to produce p1-51-GFP (p1-200-GFP, p1-250-GFP and p161-250-GFP ) and p161-368-GFP, respectively(Figure 1A). Full-length human ZNF24 was amplified by PCR and was cloned into the Xho I/Sac II sites of pEGFP-N1 yielding pEGFP-ZNF24. The plasmid p1.5kb-Luc used for promoter reporter assays was made by polymerase chain reaction (PCR) from human genomic DNA, and subcloned into the Kpn I/Hind III sites of luciferase expression vector pGL3 basic (Promega). The primers are as follows: forward, 5’- ggaggtaccGACGGCAGTTGGCATTAC -3’; reverse, 5’-ggaaagcttGCTCCTCAGACCTTCCTCC-3’. The point mutations and internal deletions were carried out using site-directed mutagenesis by overlapping PCR. The primer pairs (forward/reverse) used to generate the point and internal deletion mutants are as follows. K258A: TGAATGTGGAGCACACTTCAGT/ ACTGAAGTGTGCTCCACATCA; S261A: AACACTTCGCTCAGGGCTCA/TG AGCCCTGAGCGAAGTGTT; S264A: AGAATTCACGCTGGGGAGAA/TTCTCC CCAGCGTGAATTCT; R271A: TCTTCATCAAGCAATTCACAGTG/CACTGTG AATTGCTTGATGAAGA; S274A: AGAATTCACGCTGGGGAGAAAC/GTT TCTCCCCAGCGTGAATTCT; K277A: ATTCACAGTGGGGAGGCACCTTATG GATGTGTT/AACACATCCATAAGGTGCCTCCCCACTGTGAAT; Y279A: GTG GGGAGAAACCTGCTGGATGTGTTGAGT/ACTCAACACATCCAGCAGGTTT CTCCCCAC;K286A: TGTGTTGAGTGTGGGGCAGCATTCAGCCGAAG/CTTC GGCTGAATGCTGCCCCACACTCAACACA; S289A: GAAAGCATTCGCCCGA AGTTCC/GGAACTTCGGGCGAATGCTTTC; R290A: GGAAAGCATTCAGCG CAAGTTCCATTCTTGTGC/GCACAAGAATGGAACTTGCGCTGAATGCTTTC C; S291A: TCAGCCGAGCTTCCATTCTT/AAGAATGGAAGCTCGGCTGA; S292A: AGCCGAAGTGCCATTCTTGTG/CACAAGAATGGCACTTCGGCT; R299A: CTTGTGCAACACCAGGCAGTCCACCCGCGGG/CCCGCGGGTGG ACTGCCTGGTGTTGCACA AG; H269/273L: CTTATTCTTCTTCAAAGAATT CTCAGTGGGGA/TCCCCACTGAGAATTCTTTGAAGAAGAATAAG; H297/ 301L: TGTGCAACTCCAGAGAGTCCTCACTGGAGA/TCTCCAGTGAGG ACT CTCTGGAGTTGCACA; dZF1-2: CTCTCGAAAGAAACAAACTGGAGA AAAACCTTA/TAAGGTTTTTCTCCAGTTTGTTTCTTTCGAGAG; dZF1: CTCTCGAAAGAAACAAAGTGGGGAGAAACCTT/AAGGTTTCTCCCCACTT TGTTTCTTTCGAGAG; dZF2: TCATCAAAGAATTCACACTGGAGAAAAACC TT/AAGGTTTTTCTCCAGTGTGAATTCTTTGATGA. The sequences of all constructs were confirmed by DNA sequencing.

Bottom Line: Our results delimit the NLS to ZF1-2.ZNF24 containing histidine to leucine mutations that disrupt the structure of ZF1 or/and ZF2 retains appropriate nuclear localization, indicating that neither the tertiary structure of the zinc fingers nor specific DNA binding are necessary for nuclear localization.Taken together, these results suggest that consecutive ZF1-2 is critical for the regulation of ZNF24 nuclear localization and its transactivation function.

View Article: PubMed Central - PubMed

Affiliation: Department of Biochemical Pharmacy, Second Military Medical University, Shanghai, China.

ABSTRACT
ZNF24 is a member of the SCAN domain family of Krüppel-like zinc finger (ZF) transcription factors, which plays a critical role in cell proliferation and differentiation. However, how ZNF24 enters the nucleus in order to exert its function remains unclear since its nuclear localization signal(s) (NLS) has not been identified. Here, we generated a series of GFP-tagged deletion and point mutants and assessed their subcellular localization. Our results delimit the NLS to ZF1-2. Deletion of ZF1-2 caused cytoplasmic accumulation of ZNF24. Fusion of the ZF1-2 to green fluorescent protein (GFP) targeted GFP to the nucleus, demonstrating that the ZF1-2 is both necessary and sufficient for nuclear localization. ZNF24 containing histidine to leucine mutations that disrupt the structure of ZF1 or/and ZF2 retains appropriate nuclear localization, indicating that neither the tertiary structure of the zinc fingers nor specific DNA binding are necessary for nuclear localization. K286A and R290A mutation led to partial cytoplasmic accumulation. Co-immunoprecipitation demonstrated that ZNF24 interacted with importin-β and this interaction required the ZF motifs. The β-Catenin (CTNNB1) luciferase assays showed that the ZNF24 mutants defective in nuclear localization could not promote CTNNB1 promoter activation as the wild-type ZNF24 did. Taken together, these results suggest that consecutive ZF1-2 is critical for the regulation of ZNF24 nuclear localization and its transactivation function.

Show MeSH
Related in: MedlinePlus