Limits...
Transactivation specificity is conserved among p53 family proteins and depends on a response element sequence code.

Ciribilli Y, Monti P, Bisio A, Nguyen HT, Ethayathulla AS, Ramos A, Foggetti G, Menichini P, Menendez D, Resnick MA, Viadiu H, Fronza G, Inga A - Nucleic Acids Res. (2013)

Bottom Line: We identified mutations at conserved amino acids of loops L1 and L3 in the DNA-binding domain that tune the transactivation potential nearly equally in p73, p63 and p53.For example, the mutant S139F in p73 has higher transactivation potential towards selected REs, enhanced DNA-binding cooperativity in vitro and a flexible loop L1 as seen in the crystal structure of the protein-DNA complex.By studying, how variations in the RE sequence affect transactivation specificity, we discovered a RE-transactivation code that predicts enhanced transactivation; this correlation is stronger for promoters of genes associated with apoptosis.

View Article: PubMed Central - PubMed

Affiliation: Laboratory of Transcriptional Networks, Centre for Integrative Biology (CIBIO), University of Trento, TN, 38060 Italy, Molecular Mutagenesis and DNA Repair Unit, IRCSS Azienda Ospedaliera Universitaria San Martino-IST-Istituto Nazionale per la Ricerca sul Cancro, Genoa 16132, Italy, Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, 92093, USA and Chromosome Stability Group, Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, NIEHS, NIH, RTP, NC, 27709, USA.

ABSTRACT
Structural and biochemical studies have demonstrated that p73, p63 and p53 recognize DNA with identical amino acids and similar binding affinity. Here, measuring transactivation activity for a large number of response elements (REs) in yeast and human cell lines, we show that p53 family proteins also have overlapping transactivation profiles. We identified mutations at conserved amino acids of loops L1 and L3 in the DNA-binding domain that tune the transactivation potential nearly equally in p73, p63 and p53. For example, the mutant S139F in p73 has higher transactivation potential towards selected REs, enhanced DNA-binding cooperativity in vitro and a flexible loop L1 as seen in the crystal structure of the protein-DNA complex. By studying, how variations in the RE sequence affect transactivation specificity, we discovered a RE-transactivation code that predicts enhanced transactivation; this correlation is stronger for promoters of genes associated with apoptosis.

Show MeSH
DNA-binding constants of the p73 S139F DBD mutant and the ΔNp73δ isoform for GGGCA and GAACA sequences. (A) The plot shows the fraction of fluorescein-conjugated GGGCA ½-site RE bound versus the added concentration of pure p73DBD S139F mutant. The sigmoidal dose-response curve was fit with a Hill coefficient different than 1. The error bars indicate the standard deviation between three data sets. The Kd was the concentration of p73 S139F DBD where 50% of the DNA substrate was bound to the protein. (B) The same procedure was repeated with the GGGCA full-site RE, showing even tighter binding with a Kd ∼7-fold lower in value. (C) Same as (B), but for the ΔNp73δ isoform. (D) Same as (A), but with a GAACA ½-site RE. (E) Same as (B), but with a GAACA full-site RE. The GAACA REs have much lower binding affinity than their GGGCA counterparts. (F) Same as (E), but for the ΔNp73δ isoform. The p73 S139F mutant has similar DNA affinity and specificity that the ΔNp73δ isoform.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3794606&req=5

gkt657-F6: DNA-binding constants of the p73 S139F DBD mutant and the ΔNp73δ isoform for GGGCA and GAACA sequences. (A) The plot shows the fraction of fluorescein-conjugated GGGCA ½-site RE bound versus the added concentration of pure p73DBD S139F mutant. The sigmoidal dose-response curve was fit with a Hill coefficient different than 1. The error bars indicate the standard deviation between three data sets. The Kd was the concentration of p73 S139F DBD where 50% of the DNA substrate was bound to the protein. (B) The same procedure was repeated with the GGGCA full-site RE, showing even tighter binding with a Kd ∼7-fold lower in value. (C) Same as (B), but for the ΔNp73δ isoform. (D) Same as (A), but with a GAACA ½-site RE. (E) Same as (B), but with a GAACA full-site RE. The GAACA REs have much lower binding affinity than their GGGCA counterparts. (F) Same as (E), but for the ΔNp73δ isoform. The p73 S139F mutant has similar DNA affinity and specificity that the ΔNp73δ isoform.

Mentions: The correlation between relative transactivation potential and DNA-binding affinity of p73 S139F was then investigated using purified mutant DBD protein with four DNA consensus sequences and measuring fluorescence polarization. The dissociation constants (Kd) were determined to be 1540 nM for the 12mer GGGCA ½-site (tGGGCATGCCCa) and 230 nM for the 20-mer GGGCA full-site (GGGCATGCCCGGGCATGCCC) (4/4 RY signature) with Hill coefficients of 1.5 ± 0.2 and 1.9 ± 0.2, respectively (Figure 6A and B). The Kd’s of the 12mer GAACA ½-site (cGAACATGTTCg) and the 20mer GAACA full-site (GAACATGTTCGAACATGTTC) (0/4 RY signature) were determined to be >85 980 nM and 4480 nM with a Hill coefficient of 1.7 ± 0.1 (Figure 6D and E). Because the difference in DNA affinity of the mutant S139F towards the GGGCA full-site was 10 times stronger (230 nM) than what we had observed for the p73 DBD WT (2387 nM) (26), we decided to further explore the nature of this difference with proteins that contained the OD. We measured the binding affinity of the WT ΔNp73δ isoform for both 20mer sequences obtaining Kd values of 160 and 940 nM with the GGGCA and GAACA sequences, respectively (Figure 6C and F). Interestingly, we observed that the S139F mutant behaves in a similar fashion as the ΔNp73δ isoform that includes both the DNA-binding and the ODs. Both proteins show cooperativity, and both have the ability to preferentially bind to the GGGCA 20mer. Thus, S139F binds cooperatively to both full-site sequences, whereas the different Kd values were consistent with its transactivation properties according to the RY signature.Figure 6.


Transactivation specificity is conserved among p53 family proteins and depends on a response element sequence code.

Ciribilli Y, Monti P, Bisio A, Nguyen HT, Ethayathulla AS, Ramos A, Foggetti G, Menichini P, Menendez D, Resnick MA, Viadiu H, Fronza G, Inga A - Nucleic Acids Res. (2013)

DNA-binding constants of the p73 S139F DBD mutant and the ΔNp73δ isoform for GGGCA and GAACA sequences. (A) The plot shows the fraction of fluorescein-conjugated GGGCA ½-site RE bound versus the added concentration of pure p73DBD S139F mutant. The sigmoidal dose-response curve was fit with a Hill coefficient different than 1. The error bars indicate the standard deviation between three data sets. The Kd was the concentration of p73 S139F DBD where 50% of the DNA substrate was bound to the protein. (B) The same procedure was repeated with the GGGCA full-site RE, showing even tighter binding with a Kd ∼7-fold lower in value. (C) Same as (B), but for the ΔNp73δ isoform. (D) Same as (A), but with a GAACA ½-site RE. (E) Same as (B), but with a GAACA full-site RE. The GAACA REs have much lower binding affinity than their GGGCA counterparts. (F) Same as (E), but for the ΔNp73δ isoform. The p73 S139F mutant has similar DNA affinity and specificity that the ΔNp73δ isoform.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3794606&req=5

gkt657-F6: DNA-binding constants of the p73 S139F DBD mutant and the ΔNp73δ isoform for GGGCA and GAACA sequences. (A) The plot shows the fraction of fluorescein-conjugated GGGCA ½-site RE bound versus the added concentration of pure p73DBD S139F mutant. The sigmoidal dose-response curve was fit with a Hill coefficient different than 1. The error bars indicate the standard deviation between three data sets. The Kd was the concentration of p73 S139F DBD where 50% of the DNA substrate was bound to the protein. (B) The same procedure was repeated with the GGGCA full-site RE, showing even tighter binding with a Kd ∼7-fold lower in value. (C) Same as (B), but for the ΔNp73δ isoform. (D) Same as (A), but with a GAACA ½-site RE. (E) Same as (B), but with a GAACA full-site RE. The GAACA REs have much lower binding affinity than their GGGCA counterparts. (F) Same as (E), but for the ΔNp73δ isoform. The p73 S139F mutant has similar DNA affinity and specificity that the ΔNp73δ isoform.
Mentions: The correlation between relative transactivation potential and DNA-binding affinity of p73 S139F was then investigated using purified mutant DBD protein with four DNA consensus sequences and measuring fluorescence polarization. The dissociation constants (Kd) were determined to be 1540 nM for the 12mer GGGCA ½-site (tGGGCATGCCCa) and 230 nM for the 20-mer GGGCA full-site (GGGCATGCCCGGGCATGCCC) (4/4 RY signature) with Hill coefficients of 1.5 ± 0.2 and 1.9 ± 0.2, respectively (Figure 6A and B). The Kd’s of the 12mer GAACA ½-site (cGAACATGTTCg) and the 20mer GAACA full-site (GAACATGTTCGAACATGTTC) (0/4 RY signature) were determined to be >85 980 nM and 4480 nM with a Hill coefficient of 1.7 ± 0.1 (Figure 6D and E). Because the difference in DNA affinity of the mutant S139F towards the GGGCA full-site was 10 times stronger (230 nM) than what we had observed for the p73 DBD WT (2387 nM) (26), we decided to further explore the nature of this difference with proteins that contained the OD. We measured the binding affinity of the WT ΔNp73δ isoform for both 20mer sequences obtaining Kd values of 160 and 940 nM with the GGGCA and GAACA sequences, respectively (Figure 6C and F). Interestingly, we observed that the S139F mutant behaves in a similar fashion as the ΔNp73δ isoform that includes both the DNA-binding and the ODs. Both proteins show cooperativity, and both have the ability to preferentially bind to the GGGCA 20mer. Thus, S139F binds cooperatively to both full-site sequences, whereas the different Kd values were consistent with its transactivation properties according to the RY signature.Figure 6.

Bottom Line: We identified mutations at conserved amino acids of loops L1 and L3 in the DNA-binding domain that tune the transactivation potential nearly equally in p73, p63 and p53.For example, the mutant S139F in p73 has higher transactivation potential towards selected REs, enhanced DNA-binding cooperativity in vitro and a flexible loop L1 as seen in the crystal structure of the protein-DNA complex.By studying, how variations in the RE sequence affect transactivation specificity, we discovered a RE-transactivation code that predicts enhanced transactivation; this correlation is stronger for promoters of genes associated with apoptosis.

View Article: PubMed Central - PubMed

Affiliation: Laboratory of Transcriptional Networks, Centre for Integrative Biology (CIBIO), University of Trento, TN, 38060 Italy, Molecular Mutagenesis and DNA Repair Unit, IRCSS Azienda Ospedaliera Universitaria San Martino-IST-Istituto Nazionale per la Ricerca sul Cancro, Genoa 16132, Italy, Department of Chemistry and Biochemistry, University of California San Diego, La Jolla, CA, 92093, USA and Chromosome Stability Group, Laboratory of Molecular Genetics, National Institute of Environmental Health Sciences, NIEHS, NIH, RTP, NC, 27709, USA.

ABSTRACT
Structural and biochemical studies have demonstrated that p73, p63 and p53 recognize DNA with identical amino acids and similar binding affinity. Here, measuring transactivation activity for a large number of response elements (REs) in yeast and human cell lines, we show that p53 family proteins also have overlapping transactivation profiles. We identified mutations at conserved amino acids of loops L1 and L3 in the DNA-binding domain that tune the transactivation potential nearly equally in p73, p63 and p53. For example, the mutant S139F in p73 has higher transactivation potential towards selected REs, enhanced DNA-binding cooperativity in vitro and a flexible loop L1 as seen in the crystal structure of the protein-DNA complex. By studying, how variations in the RE sequence affect transactivation specificity, we discovered a RE-transactivation code that predicts enhanced transactivation; this correlation is stronger for promoters of genes associated with apoptosis.

Show MeSH