Limits...
Two novel mitoviruses from a Canadian isolate of the Dutch elm pathogen Ophiostoma novo-ulmi (93-1224).

Hintz WE, Carneiro JS, Kassatenko I, Varga A, James D - Virol. J. (2013)

Bottom Line: Numerous mitigation strategies have been tried to eradicate this pathogen, but success has thus far been limited.An alternative approach might utilize double-stranded RNA (dsRNA) mycoviruses which have been reported to induce hypovirulence in other fungi.Naïve fungal hosts could be infected with both the engineered molecule and a helper mitovirus encoding an RdRp which would provide replication capacity for both molecules.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Biology, University of Victoria, P.O. Box 3020 STN CSC, Victoria, BC V8W 3N5, Canada. whintz@uvic.ca

ABSTRACT

Background: Ophiostoma novo-ulmi is the causative agent of Dutch elm disease (DED). It is an ascomycetous filamentous fungus that ranks as the third most devastating fungal pathogen in Canada. The disease front has spread eastward and westward from the epicentre in Ontario and Quebec and is threatening elm populations across the country. Numerous mitigation strategies have been tried to eradicate this pathogen, but success has thus far been limited. An alternative approach might utilize double-stranded RNA (dsRNA) mycoviruses which have been reported to induce hypovirulence in other fungi.

Methods: Using a modified single primer amplification technique (SPAT) in combination with chromosomal walking, we have determined the genome sequence of two RdRp encoding dsRNA viruses from an O. novo-ulmi isolate (93-1224) collected from the disease front in Winnipeg.

Results: We propose that these viruses, which we have named OnuMV1c and OnuMV7 based on sequence similarity to other Ophiostoma mitoviruses, are two new members of the genus Mitovirus in the family Narnaviridae.

Conclusions: The discovery of such dsRNA elements raises the potential for engineering these viruses to include other genetic elements, such as anti-sense or interfering RNAs, to create novel and highly specific biological controls. Naïve fungal hosts could be infected with both the engineered molecule and a helper mitovirus encoding an RdRp which would provide replication capacity for both molecules.

Show MeSH

Related in: MedlinePlus

Potential secondary structures of the ends of dsRNA01 (OnuMV1c) and dsRNA03. A. The potential 5′ and 3′ terminal snap-back secondary structures of O. novo-ulmi mitovirus OnuMV1c in isolate 93–1224 are shown along with a potential panhandle structure of the (+) strand. B. Potential snap-back structures were located at the 5′ and 3′ ends of the dsRNA 03 which lacked significant coding function. An energetically favorable panhandle structure could not be definitively located for dsRNA03.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3750502&req=5

Figure 6: Potential secondary structures of the ends of dsRNA01 (OnuMV1c) and dsRNA03. A. The potential 5′ and 3′ terminal snap-back secondary structures of O. novo-ulmi mitovirus OnuMV1c in isolate 93–1224 are shown along with a potential panhandle structure of the (+) strand. B. Potential snap-back structures were located at the 5′ and 3′ ends of the dsRNA 03 which lacked significant coding function. An energetically favorable panhandle structure could not be definitively located for dsRNA03.

Mentions: The 5′- and 3′- UTRs of dsRNA 01 (OnuMV1c), measuring 440 and 303 bp in length respectively, were examined for potential secondary structures using the RNAfold algorithm which predicts the structure summarizing free positive or negative energy change associated with all possible pairing. An examination of the positive strand of the RNA sequence showed that the first 47 bp of 5′- terminal sequence of the positive strand (1GGACCGUAUGGGGUCGCUGACUUUCGCGAGUCAGAAACCUCCGUACG47) could potentially be folded into a double-stranded stem-loop structure (free energy −24.11 kcal/mol) with 4 unpaired nucleotides at the 5′ end (Figure 6A). The 30 bp of 3′- terminal sequence (3077AGAUAGUAAGGAGUCUAGCUCCUAACGGUCC3107) also had the potential to be folded into a double-stranded stem-loop structure with free energy −11.25 kcal/mol (Figure 6A). A potential panhandle structure between the 5′ and 3′ UTR regions was also predicted with a free energy of −20.56 kcal/mol (Figure 6A). There were no obvious stem-loop structures or panhandle structures in the upstream or downstream UTRs of dsRNA 02 (OnuMV7). This was consistent with the finding that this molecule occurred as either a closed circular molecule or occurred as a concatemer. The dsRNA 03 had stem-loop structures at both ends of the molecule corresponding to (1CCGAACGCUUUCAUUGAAAUGAUAGCCCGUUUGG34) with a free energy of −10.88 kcal/mol and (999GGGGACAUAGCAGCUUCCUUGAAGCUGUUAUGGCCG1034) with a free energy of −19.67 kcal/mol (Figure 6A). While there was potential to form a pan-handle structure the likelihood of snap back to the stem-loop structure was much greater. The dsRNA 04 had a stem-loop structure at the 5′ terminus of the molecule but not at the 3′ terminus and may in fact represent an incomplete or truncated sequence (not shown).


Two novel mitoviruses from a Canadian isolate of the Dutch elm pathogen Ophiostoma novo-ulmi (93-1224).

Hintz WE, Carneiro JS, Kassatenko I, Varga A, James D - Virol. J. (2013)

Potential secondary structures of the ends of dsRNA01 (OnuMV1c) and dsRNA03. A. The potential 5′ and 3′ terminal snap-back secondary structures of O. novo-ulmi mitovirus OnuMV1c in isolate 93–1224 are shown along with a potential panhandle structure of the (+) strand. B. Potential snap-back structures were located at the 5′ and 3′ ends of the dsRNA 03 which lacked significant coding function. An energetically favorable panhandle structure could not be definitively located for dsRNA03.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3750502&req=5

Figure 6: Potential secondary structures of the ends of dsRNA01 (OnuMV1c) and dsRNA03. A. The potential 5′ and 3′ terminal snap-back secondary structures of O. novo-ulmi mitovirus OnuMV1c in isolate 93–1224 are shown along with a potential panhandle structure of the (+) strand. B. Potential snap-back structures were located at the 5′ and 3′ ends of the dsRNA 03 which lacked significant coding function. An energetically favorable panhandle structure could not be definitively located for dsRNA03.
Mentions: The 5′- and 3′- UTRs of dsRNA 01 (OnuMV1c), measuring 440 and 303 bp in length respectively, were examined for potential secondary structures using the RNAfold algorithm which predicts the structure summarizing free positive or negative energy change associated with all possible pairing. An examination of the positive strand of the RNA sequence showed that the first 47 bp of 5′- terminal sequence of the positive strand (1GGACCGUAUGGGGUCGCUGACUUUCGCGAGUCAGAAACCUCCGUACG47) could potentially be folded into a double-stranded stem-loop structure (free energy −24.11 kcal/mol) with 4 unpaired nucleotides at the 5′ end (Figure 6A). The 30 bp of 3′- terminal sequence (3077AGAUAGUAAGGAGUCUAGCUCCUAACGGUCC3107) also had the potential to be folded into a double-stranded stem-loop structure with free energy −11.25 kcal/mol (Figure 6A). A potential panhandle structure between the 5′ and 3′ UTR regions was also predicted with a free energy of −20.56 kcal/mol (Figure 6A). There were no obvious stem-loop structures or panhandle structures in the upstream or downstream UTRs of dsRNA 02 (OnuMV7). This was consistent with the finding that this molecule occurred as either a closed circular molecule or occurred as a concatemer. The dsRNA 03 had stem-loop structures at both ends of the molecule corresponding to (1CCGAACGCUUUCAUUGAAAUGAUAGCCCGUUUGG34) with a free energy of −10.88 kcal/mol and (999GGGGACAUAGCAGCUUCCUUGAAGCUGUUAUGGCCG1034) with a free energy of −19.67 kcal/mol (Figure 6A). While there was potential to form a pan-handle structure the likelihood of snap back to the stem-loop structure was much greater. The dsRNA 04 had a stem-loop structure at the 5′ terminus of the molecule but not at the 3′ terminus and may in fact represent an incomplete or truncated sequence (not shown).

Bottom Line: Numerous mitigation strategies have been tried to eradicate this pathogen, but success has thus far been limited.An alternative approach might utilize double-stranded RNA (dsRNA) mycoviruses which have been reported to induce hypovirulence in other fungi.Naïve fungal hosts could be infected with both the engineered molecule and a helper mitovirus encoding an RdRp which would provide replication capacity for both molecules.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Biology, University of Victoria, P.O. Box 3020 STN CSC, Victoria, BC V8W 3N5, Canada. whintz@uvic.ca

ABSTRACT

Background: Ophiostoma novo-ulmi is the causative agent of Dutch elm disease (DED). It is an ascomycetous filamentous fungus that ranks as the third most devastating fungal pathogen in Canada. The disease front has spread eastward and westward from the epicentre in Ontario and Quebec and is threatening elm populations across the country. Numerous mitigation strategies have been tried to eradicate this pathogen, but success has thus far been limited. An alternative approach might utilize double-stranded RNA (dsRNA) mycoviruses which have been reported to induce hypovirulence in other fungi.

Methods: Using a modified single primer amplification technique (SPAT) in combination with chromosomal walking, we have determined the genome sequence of two RdRp encoding dsRNA viruses from an O. novo-ulmi isolate (93-1224) collected from the disease front in Winnipeg.

Results: We propose that these viruses, which we have named OnuMV1c and OnuMV7 based on sequence similarity to other Ophiostoma mitoviruses, are two new members of the genus Mitovirus in the family Narnaviridae.

Conclusions: The discovery of such dsRNA elements raises the potential for engineering these viruses to include other genetic elements, such as anti-sense or interfering RNAs, to create novel and highly specific biological controls. Naïve fungal hosts could be infected with both the engineered molecule and a helper mitovirus encoding an RdRp which would provide replication capacity for both molecules.

Show MeSH
Related in: MedlinePlus