Limits...
Two novel mitoviruses from a Canadian isolate of the Dutch elm pathogen Ophiostoma novo-ulmi (93-1224).

Hintz WE, Carneiro JS, Kassatenko I, Varga A, James D - Virol. J. (2013)

Bottom Line: Numerous mitigation strategies have been tried to eradicate this pathogen, but success has thus far been limited.An alternative approach might utilize double-stranded RNA (dsRNA) mycoviruses which have been reported to induce hypovirulence in other fungi.Naïve fungal hosts could be infected with both the engineered molecule and a helper mitovirus encoding an RdRp which would provide replication capacity for both molecules.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Biology, University of Victoria, P.O. Box 3020 STN CSC, Victoria, BC V8W 3N5, Canada. whintz@uvic.ca

ABSTRACT

Background: Ophiostoma novo-ulmi is the causative agent of Dutch elm disease (DED). It is an ascomycetous filamentous fungus that ranks as the third most devastating fungal pathogen in Canada. The disease front has spread eastward and westward from the epicentre in Ontario and Quebec and is threatening elm populations across the country. Numerous mitigation strategies have been tried to eradicate this pathogen, but success has thus far been limited. An alternative approach might utilize double-stranded RNA (dsRNA) mycoviruses which have been reported to induce hypovirulence in other fungi.

Methods: Using a modified single primer amplification technique (SPAT) in combination with chromosomal walking, we have determined the genome sequence of two RdRp encoding dsRNA viruses from an O. novo-ulmi isolate (93-1224) collected from the disease front in Winnipeg.

Results: We propose that these viruses, which we have named OnuMV1c and OnuMV7 based on sequence similarity to other Ophiostoma mitoviruses, are two new members of the genus Mitovirus in the family Narnaviridae.

Conclusions: The discovery of such dsRNA elements raises the potential for engineering these viruses to include other genetic elements, such as anti-sense or interfering RNAs, to create novel and highly specific biological controls. Naïve fungal hosts could be infected with both the engineered molecule and a helper mitovirus encoding an RdRp which would provide replication capacity for both molecules.

Show MeSH

Related in: MedlinePlus

Schematic representation of alignment of a series of SPAT and partial cDNA clones derived from the dsRNAs of O. novo-ulmi isolate 93–1224. Contiguous sequences were initially collated by alignment of SPAT clones (black bars). The primers 5′TGCAATTTGTTGCTAGTGGA3′ and 5′ACCTGCAACAAGTAACAATCTGG3′ were used to make cDNA 1 and cDNA 2 according to SPAT 8 and the primer 5′CTATATACAGTTAATATTAATTACAGGTAGATATGCTATGATATTTACAAATATCACTTATTAAACG3′ was used to make cDNA 3 according to SPAT 10 (dashed lines). The linkages between contigs were determined by chromosome walking (indicated by lines with arrows) leading to a final assembly for dsRNAs 01–04. A single large ORF (white boxes) with the potential to encode RNA-dependent RNA Polymerases (RdRPs) was predicted for dsRNAs 01 and 02 while other smaller ORFs were detected in dsRNAs 03 and 04.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3750502&req=5

Figure 1: Schematic representation of alignment of a series of SPAT and partial cDNA clones derived from the dsRNAs of O. novo-ulmi isolate 93–1224. Contiguous sequences were initially collated by alignment of SPAT clones (black bars). The primers 5′TGCAATTTGTTGCTAGTGGA3′ and 5′ACCTGCAACAAGTAACAATCTGG3′ were used to make cDNA 1 and cDNA 2 according to SPAT 8 and the primer 5′CTATATACAGTTAATATTAATTACAGGTAGATATGCTATGATATTTACAAATATCACTTATTAAACG3′ was used to make cDNA 3 according to SPAT 10 (dashed lines). The linkages between contigs were determined by chromosome walking (indicated by lines with arrows) leading to a final assembly for dsRNAs 01–04. A single large ORF (white boxes) with the potential to encode RNA-dependent RNA Polymerases (RdRPs) was predicted for dsRNAs 01 and 02 while other smaller ORFs were detected in dsRNAs 03 and 04.

Mentions: The application of the single primer amplification technique (SPAT) to purified dsRNA from O. novo-ulmi 93–1224 as a template yielded nineteen unique cDNA clones many of which showed sequence similarity to RdRps (Figure 1). The sequences were compared to the genomic sequences of O. novo-ulmi H327 to determine whether there was any sequence similarity to known nuclear or mitochondrial sequences[16]. Each of the clones were unique to isolate 93–1224. Where possible overlapping SPAT clones were assembled into continuous sequences. Many of the SPAT clones ended at the same position suggesting the ends of discrete dsRNA molecules. To facilitate linkage between SPAT clones, cDNAs were constructed according to characterized sequence of SPAT clones 8 and 10 and the gap regions determined by chromosome walking. Four separate complete contigs were developed corresponding to dsRNA 01 (3107 nt), dsRNA 02 (2804 nt), dsRNA 03 (1035 nt) and dsRNA 04 (632 nt) (Figure 1). None of the sequences were polyadenylated. 5′ Rapid Amplification of cDNA Ends (RACE) confirmed that dsRNA 01 was a linear molecule with the ends defined by SPAT 1 and SPAT 4. The last 110 bp of SPAT 12 overlapped with the first 110 bp of SPAT 9 suggesting that dsRNA 02 was either a closed circular molecule or occurred as a series of concatemers (Figure 1). This was confirmed by chromosome walking from SPAT 12 which extended the 5′ untranslated region (UTR) sequence a further 72 bp into the next repeating unit and discrete ends to the repeating unit could not be determined (Figure 1). The nominative 5′ and 3′ UTRs for dsRNA 02 were assigned according the 5′ end of SPAT 9 as five independently derived versions of this clone ending at this position were discovered. The two smallest contigs, representing dsRNA 03 and dsRNA 04 appeared to be linear. There was no sequence similarity between any of the four contigs.


Two novel mitoviruses from a Canadian isolate of the Dutch elm pathogen Ophiostoma novo-ulmi (93-1224).

Hintz WE, Carneiro JS, Kassatenko I, Varga A, James D - Virol. J. (2013)

Schematic representation of alignment of a series of SPAT and partial cDNA clones derived from the dsRNAs of O. novo-ulmi isolate 93–1224. Contiguous sequences were initially collated by alignment of SPAT clones (black bars). The primers 5′TGCAATTTGTTGCTAGTGGA3′ and 5′ACCTGCAACAAGTAACAATCTGG3′ were used to make cDNA 1 and cDNA 2 according to SPAT 8 and the primer 5′CTATATACAGTTAATATTAATTACAGGTAGATATGCTATGATATTTACAAATATCACTTATTAAACG3′ was used to make cDNA 3 according to SPAT 10 (dashed lines). The linkages between contigs were determined by chromosome walking (indicated by lines with arrows) leading to a final assembly for dsRNAs 01–04. A single large ORF (white boxes) with the potential to encode RNA-dependent RNA Polymerases (RdRPs) was predicted for dsRNAs 01 and 02 while other smaller ORFs were detected in dsRNAs 03 and 04.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3750502&req=5

Figure 1: Schematic representation of alignment of a series of SPAT and partial cDNA clones derived from the dsRNAs of O. novo-ulmi isolate 93–1224. Contiguous sequences were initially collated by alignment of SPAT clones (black bars). The primers 5′TGCAATTTGTTGCTAGTGGA3′ and 5′ACCTGCAACAAGTAACAATCTGG3′ were used to make cDNA 1 and cDNA 2 according to SPAT 8 and the primer 5′CTATATACAGTTAATATTAATTACAGGTAGATATGCTATGATATTTACAAATATCACTTATTAAACG3′ was used to make cDNA 3 according to SPAT 10 (dashed lines). The linkages between contigs were determined by chromosome walking (indicated by lines with arrows) leading to a final assembly for dsRNAs 01–04. A single large ORF (white boxes) with the potential to encode RNA-dependent RNA Polymerases (RdRPs) was predicted for dsRNAs 01 and 02 while other smaller ORFs were detected in dsRNAs 03 and 04.
Mentions: The application of the single primer amplification technique (SPAT) to purified dsRNA from O. novo-ulmi 93–1224 as a template yielded nineteen unique cDNA clones many of which showed sequence similarity to RdRps (Figure 1). The sequences were compared to the genomic sequences of O. novo-ulmi H327 to determine whether there was any sequence similarity to known nuclear or mitochondrial sequences[16]. Each of the clones were unique to isolate 93–1224. Where possible overlapping SPAT clones were assembled into continuous sequences. Many of the SPAT clones ended at the same position suggesting the ends of discrete dsRNA molecules. To facilitate linkage between SPAT clones, cDNAs were constructed according to characterized sequence of SPAT clones 8 and 10 and the gap regions determined by chromosome walking. Four separate complete contigs were developed corresponding to dsRNA 01 (3107 nt), dsRNA 02 (2804 nt), dsRNA 03 (1035 nt) and dsRNA 04 (632 nt) (Figure 1). None of the sequences were polyadenylated. 5′ Rapid Amplification of cDNA Ends (RACE) confirmed that dsRNA 01 was a linear molecule with the ends defined by SPAT 1 and SPAT 4. The last 110 bp of SPAT 12 overlapped with the first 110 bp of SPAT 9 suggesting that dsRNA 02 was either a closed circular molecule or occurred as a series of concatemers (Figure 1). This was confirmed by chromosome walking from SPAT 12 which extended the 5′ untranslated region (UTR) sequence a further 72 bp into the next repeating unit and discrete ends to the repeating unit could not be determined (Figure 1). The nominative 5′ and 3′ UTRs for dsRNA 02 were assigned according the 5′ end of SPAT 9 as five independently derived versions of this clone ending at this position were discovered. The two smallest contigs, representing dsRNA 03 and dsRNA 04 appeared to be linear. There was no sequence similarity between any of the four contigs.

Bottom Line: Numerous mitigation strategies have been tried to eradicate this pathogen, but success has thus far been limited.An alternative approach might utilize double-stranded RNA (dsRNA) mycoviruses which have been reported to induce hypovirulence in other fungi.Naïve fungal hosts could be infected with both the engineered molecule and a helper mitovirus encoding an RdRp which would provide replication capacity for both molecules.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Biology, University of Victoria, P.O. Box 3020 STN CSC, Victoria, BC V8W 3N5, Canada. whintz@uvic.ca

ABSTRACT

Background: Ophiostoma novo-ulmi is the causative agent of Dutch elm disease (DED). It is an ascomycetous filamentous fungus that ranks as the third most devastating fungal pathogen in Canada. The disease front has spread eastward and westward from the epicentre in Ontario and Quebec and is threatening elm populations across the country. Numerous mitigation strategies have been tried to eradicate this pathogen, but success has thus far been limited. An alternative approach might utilize double-stranded RNA (dsRNA) mycoviruses which have been reported to induce hypovirulence in other fungi.

Methods: Using a modified single primer amplification technique (SPAT) in combination with chromosomal walking, we have determined the genome sequence of two RdRp encoding dsRNA viruses from an O. novo-ulmi isolate (93-1224) collected from the disease front in Winnipeg.

Results: We propose that these viruses, which we have named OnuMV1c and OnuMV7 based on sequence similarity to other Ophiostoma mitoviruses, are two new members of the genus Mitovirus in the family Narnaviridae.

Conclusions: The discovery of such dsRNA elements raises the potential for engineering these viruses to include other genetic elements, such as anti-sense or interfering RNAs, to create novel and highly specific biological controls. Naïve fungal hosts could be infected with both the engineered molecule and a helper mitovirus encoding an RdRp which would provide replication capacity for both molecules.

Show MeSH
Related in: MedlinePlus