Limits...
Colonization of a Central Venous Catheter by the Hyaline Fungus Fusarium solani Species Complex: A Case Report and SEM Imaging.

Colombo A, Maccari G, Congiu T, Basso P, Baj A, Toniolo A - Case Rep Med (2013)

Bottom Line: The firm adhesion of the fungal formation to the inner surface of the catheter was evident.In the absence of systemic infection, catheter removal and prophylactic voriconazole therapy were followed by disappearance of febrile events and recovery.Thus, indwelling catheters are prone to contamination by environmental fungi.

View Article: PubMed Central - PubMed

Affiliation: Laboratory of Medical Microbiology, Department of Clinical and Experimental Medicine, University of Insubria and Ospedale di Circolo e Fondazione Macchi, 21100 Varese, Italy.

ABSTRACT
The incidence of opportunistic infections by filamentous fungi is increasing partly due to the widespread use of central venous catheters (CVC), indwelling medical devices, and antineoplastic/immunosuppressive drugs. The case of a 13-year-old boy under treatment for acute lymphoblastic leukemia is presented. The boy was readmitted to the Pediatric Ward for intermittent fever of unknown origin. Results of blood cultures drawn from peripheral venous sites or through the CVC were compared. CVC-derived bottles (but not those from peripheral veins) yielded hyaline fungi that, based on morphology, were identified as belonging to the Fusarium solani species complex. Gene amplification and direct sequencing of the fungal ITS1 rRNA region and the EF-1alpha gene confirmed the isolate as belonging to the Fusarium solani species complex. Portions of the CVC were analyzed by scanning electron microscopy. Fungi mycelia with long protruding hyphae were seen into the lumen. The firm adhesion of the fungal formation to the inner surface of the catheter was evident. In the absence of systemic infection, catheter removal and prophylactic voriconazole therapy were followed by disappearance of febrile events and recovery. Thus, indwelling catheters are prone to contamination by environmental fungi.

No MeSH data available.


Related in: MedlinePlus

Percent nucleotide identity in the ITS1 rRNA region of isolates of Fusarium species based on sequences deposited in the NCBI database. Novel oligonucleotide primers have been designed on the basis of conserved parts of the 5.8 S rRNA region (primer ITS1-F: CGAATCTTTGAACGCACAT) and of the 28S rRNA region (primer ITS1-R: TAAGTTCAGCGGGTATTCCTAC). Sequences of the ITS1 region are variable among different isolates.
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3713600&req=5

fig1: Percent nucleotide identity in the ITS1 rRNA region of isolates of Fusarium species based on sequences deposited in the NCBI database. Novel oligonucleotide primers have been designed on the basis of conserved parts of the 5.8 S rRNA region (primer ITS1-F: CGAATCTTTGAACGCACAT) and of the 28S rRNA region (primer ITS1-R: TAAGTTCAGCGGGTATTCCTAC). Sequences of the ITS1 region are variable among different isolates.

Mentions: For obtaining genomic DNA from fungal isolates, portions of three different colonies grown in Sabouraud dextrose agar plates were suspended in 250 μL of chitinase buffer (0.50 mM phosphate buffer, pH 6.1 plus 1.6 U/mL bacterial chitinase; Sigma, St. Louis, MO, USA) and incubated at 55°C for 1 hr followed by 1 hr incubation at 56°C with 180 μL of lysis buffer plus 20 μL of proteinase K (Qiagen, Milan, Italy). DNA was purified using QIAmp spin columns (Qiagen). Molecular tests were performed in triplicate. Custom oligonucleotide primers were synthesized by Sigma-Aldrich (London, UK). A generic primer pair for amplification of the fungal 18S rRNA gene was used for preliminary identification of the isolate [5]. A novel primer pair specific for the ITS1 rRNA region was designed based on multiple alignments of the rRNA genomic fragments of pathogenic and environmental Fusarium spp. using different bioinformatic tools (COMPASSS [6]; CLC bio, Aarhus, Denmark) (Figure 1). Amplicons were also obtained for the elongation factor-1 alpha (EF-1 alpha) gene using the primers and conditions reported by Wang et al. [7]. Templates were amplified for 32 cycles (30 sec annealing and extension times) using AmpliTaq Gold DNA polymerase with buffer II (Life Technologies, Monza, Italy). PCR products were visualized by agarose gel electrophoresis using the Lonza FlashGel Fast 1.2% Agarose Gel System (EuroClone, Pero, Italy). Two ATCC strains (MYA-3636 and ATCC-90862) were used as references for the identification of F. solani species complex. Amplicons were sequenced directly using BigDye Terminator V1.1 reagents (Life Technologies) and an ABI automated sequencer. The BLAST program was used for identifying fungal sequences in databases of the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA) and of Fusarium MLST (http://www.cbs.knaw.nl/fusarium/).


Colonization of a Central Venous Catheter by the Hyaline Fungus Fusarium solani Species Complex: A Case Report and SEM Imaging.

Colombo A, Maccari G, Congiu T, Basso P, Baj A, Toniolo A - Case Rep Med (2013)

Percent nucleotide identity in the ITS1 rRNA region of isolates of Fusarium species based on sequences deposited in the NCBI database. Novel oligonucleotide primers have been designed on the basis of conserved parts of the 5.8 S rRNA region (primer ITS1-F: CGAATCTTTGAACGCACAT) and of the 28S rRNA region (primer ITS1-R: TAAGTTCAGCGGGTATTCCTAC). Sequences of the ITS1 region are variable among different isolates.
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3713600&req=5

fig1: Percent nucleotide identity in the ITS1 rRNA region of isolates of Fusarium species based on sequences deposited in the NCBI database. Novel oligonucleotide primers have been designed on the basis of conserved parts of the 5.8 S rRNA region (primer ITS1-F: CGAATCTTTGAACGCACAT) and of the 28S rRNA region (primer ITS1-R: TAAGTTCAGCGGGTATTCCTAC). Sequences of the ITS1 region are variable among different isolates.
Mentions: For obtaining genomic DNA from fungal isolates, portions of three different colonies grown in Sabouraud dextrose agar plates were suspended in 250 μL of chitinase buffer (0.50 mM phosphate buffer, pH 6.1 plus 1.6 U/mL bacterial chitinase; Sigma, St. Louis, MO, USA) and incubated at 55°C for 1 hr followed by 1 hr incubation at 56°C with 180 μL of lysis buffer plus 20 μL of proteinase K (Qiagen, Milan, Italy). DNA was purified using QIAmp spin columns (Qiagen). Molecular tests were performed in triplicate. Custom oligonucleotide primers were synthesized by Sigma-Aldrich (London, UK). A generic primer pair for amplification of the fungal 18S rRNA gene was used for preliminary identification of the isolate [5]. A novel primer pair specific for the ITS1 rRNA region was designed based on multiple alignments of the rRNA genomic fragments of pathogenic and environmental Fusarium spp. using different bioinformatic tools (COMPASSS [6]; CLC bio, Aarhus, Denmark) (Figure 1). Amplicons were also obtained for the elongation factor-1 alpha (EF-1 alpha) gene using the primers and conditions reported by Wang et al. [7]. Templates were amplified for 32 cycles (30 sec annealing and extension times) using AmpliTaq Gold DNA polymerase with buffer II (Life Technologies, Monza, Italy). PCR products were visualized by agarose gel electrophoresis using the Lonza FlashGel Fast 1.2% Agarose Gel System (EuroClone, Pero, Italy). Two ATCC strains (MYA-3636 and ATCC-90862) were used as references for the identification of F. solani species complex. Amplicons were sequenced directly using BigDye Terminator V1.1 reagents (Life Technologies) and an ABI automated sequencer. The BLAST program was used for identifying fungal sequences in databases of the National Center for Biotechnology Information (NCBI, Bethesda, MD, USA) and of Fusarium MLST (http://www.cbs.knaw.nl/fusarium/).

Bottom Line: The firm adhesion of the fungal formation to the inner surface of the catheter was evident.In the absence of systemic infection, catheter removal and prophylactic voriconazole therapy were followed by disappearance of febrile events and recovery.Thus, indwelling catheters are prone to contamination by environmental fungi.

View Article: PubMed Central - PubMed

Affiliation: Laboratory of Medical Microbiology, Department of Clinical and Experimental Medicine, University of Insubria and Ospedale di Circolo e Fondazione Macchi, 21100 Varese, Italy.

ABSTRACT
The incidence of opportunistic infections by filamentous fungi is increasing partly due to the widespread use of central venous catheters (CVC), indwelling medical devices, and antineoplastic/immunosuppressive drugs. The case of a 13-year-old boy under treatment for acute lymphoblastic leukemia is presented. The boy was readmitted to the Pediatric Ward for intermittent fever of unknown origin. Results of blood cultures drawn from peripheral venous sites or through the CVC were compared. CVC-derived bottles (but not those from peripheral veins) yielded hyaline fungi that, based on morphology, were identified as belonging to the Fusarium solani species complex. Gene amplification and direct sequencing of the fungal ITS1 rRNA region and the EF-1alpha gene confirmed the isolate as belonging to the Fusarium solani species complex. Portions of the CVC were analyzed by scanning electron microscopy. Fungi mycelia with long protruding hyphae were seen into the lumen. The firm adhesion of the fungal formation to the inner surface of the catheter was evident. In the absence of systemic infection, catheter removal and prophylactic voriconazole therapy were followed by disappearance of febrile events and recovery. Thus, indwelling catheters are prone to contamination by environmental fungi.

No MeSH data available.


Related in: MedlinePlus