Limits...
investigating acid production by Streptococcus mutans with a surface-displayed pH-sensitive green fluorescent protein.

Guo L, Hu W, He X, Lux R, McLean J, Shi W - PLoS ONE (2013)

Bottom Line: Ecliptic pHluorin was functionally displayed on the cell surface of S. mutans as a fusion protein with SpaP.Meanwhile, a non-uniform pH distribution was observed within S. mutans biofilms, reflecting differences in microbial metabolic activity.Based on these findings, the ecliptic pHluorin allows us to investigate in vivo and in situ acid production and distribution by the cariogenic species S. mutans.

View Article: PubMed Central - PubMed

Affiliation: School of Dentistry, University of California Los Angeles, Los Angeles, California, USA.

ABSTRACT
Acidogenicity and aciduricity are the main virulence factors of the cavity-causing bacterium Streptococcus mutans. Monitoring at the individual cell level the temporal and spatial distribution of acid produced by this important oral pathogen is central for our understanding of these key virulence factors especially when S. mutans resides in multi-species microbial communities. In this study, we explored the application of pH-sensitive green fluorescent proteins (pHluorins) to investigate these important features. Ecliptic pHluorin was functionally displayed on the cell surface of S. mutans as a fusion protein with SpaP. The resulting strain (O87) was used to monitor temporal and spatial pH changes in the microenvironment of S. mutans cells under both planktonic and biofilm conditions. Using strain O87, we revealed a rapid pH drop in the microenviroment of S. mutans microcolonies prior to the decrease in the macro-environment pH following sucrose fermentation. Meanwhile, a non-uniform pH distribution was observed within S. mutans biofilms, reflecting differences in microbial metabolic activity. Furthermore, strain O87 was successfully used to monitor the S. mutans acid production profiles within dual- and multispecies oral biofilms. Based on these findings, the ecliptic pHluorin allows us to investigate in vivo and in situ acid production and distribution by the cariogenic species S. mutans.

Show MeSH

Related in: MedlinePlus

Construction of S. mutans O87 with cell surface-expressed pHluorin.(A) gfp-fusion construct. The illustration shows the construct for surface-displayed expressed pHluorin in S. mutans (strain O87). The ecliptic pHluorin gene was inserted between the second and third amino acids after the identified signal-peptide cleavage site of the surface protein SpaP to enable orientating the pHluorin onto the cell wall of S. mutans. (B) Western blot with a GFP antibody shows the presence of the surface-expressed chimeric pHluorin-SpaP fusion protein (225 kDa) in S. mutans strain O87. The different cell fractions are indicated above each lane. (C) CLSM analysis of pHluorin localization in S. mutans strain O87, and wild-type cells (WT) served as control. Membrane staining with the lipophilic fluorescent dye FM 4–64 is shown in red (left), GFP signals are shown in green (middle), and the overlay images on the right. The images were taken with a 63×objective and deconvoluted to resolve cellular localization. The scale bars represent 2 µm.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC3585301&req=5

pone-0057182-g001: Construction of S. mutans O87 with cell surface-expressed pHluorin.(A) gfp-fusion construct. The illustration shows the construct for surface-displayed expressed pHluorin in S. mutans (strain O87). The ecliptic pHluorin gene was inserted between the second and third amino acids after the identified signal-peptide cleavage site of the surface protein SpaP to enable orientating the pHluorin onto the cell wall of S. mutans. (B) Western blot with a GFP antibody shows the presence of the surface-expressed chimeric pHluorin-SpaP fusion protein (225 kDa) in S. mutans strain O87. The different cell fractions are indicated above each lane. (C) CLSM analysis of pHluorin localization in S. mutans strain O87, and wild-type cells (WT) served as control. Membrane staining with the lipophilic fluorescent dye FM 4–64 is shown in red (left), GFP signals are shown in green (middle), and the overlay images on the right. The images were taken with a 63×objective and deconvoluted to resolve cellular localization. The scale bars represent 2 µm.

Mentions: The backbone vector for constructing gene fusions was pBluescript II SK (-), and pFW5 was used as suicide vector for integration of the recombinant gfp-spaP fusion into the S. mutans genome. To construct a cell surface displayed ecliptic pHluorin derivative, the 0.7 kb ecliptic pHluorin encoding ORF [16] was amplified by PCR from vector pGM87 (kindly provided by Dr. Gero Miesenbőeck) using primers phluorin-01 and phluorin-02 (Table 1). The pHluorin coding sequence with a linker sequence (accggtcccgccgcttccgccgct) at its 3′ end was then in-frame inserted via overlapping PCR between the second and third amino acids after the identified signal-peptide cleavage site of SpaP [26], a surface protein antigen-encoding gene of S. mutans. Three initial PCR reactions were performed to generate overlapping gene segments (leading sequence-gfp-linker-spaP). Internal primers ovpcr-b, -c, -d and ovpcr-e (Table 1) generated overlapping, complementary 3′ ends on the intermediate segments. Overlapping strands of these intermediate products hybridize at this 3′ region in a subsequent PCR and are extended to generate the full-length chimeric gene product amplified by flanking primers ovpcr-a and ovpcr-f (Table 1). PCR was initiated by a hot-start procedure and reaction mixture containing all other reagents except Pfu polymerase (Stratagene) was heated at 94°C for 10 sec, then brought to an 80°C holding temperature prior to addition of 5.0 U Pfu polymerase. Then cycling proceeded as follows: 94°C 10 sec, 68°C 4 min for 15 cycles; then 94°C 10 sec, 68°C, 4 min plus 15 sec extension period per cycle for further 15 cycles; followed by a 10 min extension at 72°C. A 1.1 kb DNA sequence upstream of the ldh start codon containing the ldh promoter [27] was PCR amplified from genomic DNA of S. mutans UA 140 using the primers ldh-p01 and ldh-p02 (Table 1). The resulting chimeric gene product was then ligated downstream of the lactate dehydrogenase gene (ldh) promoter (Fig. 1A, and a schematic drawing was provided as supporting information).


investigating acid production by Streptococcus mutans with a surface-displayed pH-sensitive green fluorescent protein.

Guo L, Hu W, He X, Lux R, McLean J, Shi W - PLoS ONE (2013)

Construction of S. mutans O87 with cell surface-expressed pHluorin.(A) gfp-fusion construct. The illustration shows the construct for surface-displayed expressed pHluorin in S. mutans (strain O87). The ecliptic pHluorin gene was inserted between the second and third amino acids after the identified signal-peptide cleavage site of the surface protein SpaP to enable orientating the pHluorin onto the cell wall of S. mutans. (B) Western blot with a GFP antibody shows the presence of the surface-expressed chimeric pHluorin-SpaP fusion protein (225 kDa) in S. mutans strain O87. The different cell fractions are indicated above each lane. (C) CLSM analysis of pHluorin localization in S. mutans strain O87, and wild-type cells (WT) served as control. Membrane staining with the lipophilic fluorescent dye FM 4–64 is shown in red (left), GFP signals are shown in green (middle), and the overlay images on the right. The images were taken with a 63×objective and deconvoluted to resolve cellular localization. The scale bars represent 2 µm.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC3585301&req=5

pone-0057182-g001: Construction of S. mutans O87 with cell surface-expressed pHluorin.(A) gfp-fusion construct. The illustration shows the construct for surface-displayed expressed pHluorin in S. mutans (strain O87). The ecliptic pHluorin gene was inserted between the second and third amino acids after the identified signal-peptide cleavage site of the surface protein SpaP to enable orientating the pHluorin onto the cell wall of S. mutans. (B) Western blot with a GFP antibody shows the presence of the surface-expressed chimeric pHluorin-SpaP fusion protein (225 kDa) in S. mutans strain O87. The different cell fractions are indicated above each lane. (C) CLSM analysis of pHluorin localization in S. mutans strain O87, and wild-type cells (WT) served as control. Membrane staining with the lipophilic fluorescent dye FM 4–64 is shown in red (left), GFP signals are shown in green (middle), and the overlay images on the right. The images were taken with a 63×objective and deconvoluted to resolve cellular localization. The scale bars represent 2 µm.
Mentions: The backbone vector for constructing gene fusions was pBluescript II SK (-), and pFW5 was used as suicide vector for integration of the recombinant gfp-spaP fusion into the S. mutans genome. To construct a cell surface displayed ecliptic pHluorin derivative, the 0.7 kb ecliptic pHluorin encoding ORF [16] was amplified by PCR from vector pGM87 (kindly provided by Dr. Gero Miesenbőeck) using primers phluorin-01 and phluorin-02 (Table 1). The pHluorin coding sequence with a linker sequence (accggtcccgccgcttccgccgct) at its 3′ end was then in-frame inserted via overlapping PCR between the second and third amino acids after the identified signal-peptide cleavage site of SpaP [26], a surface protein antigen-encoding gene of S. mutans. Three initial PCR reactions were performed to generate overlapping gene segments (leading sequence-gfp-linker-spaP). Internal primers ovpcr-b, -c, -d and ovpcr-e (Table 1) generated overlapping, complementary 3′ ends on the intermediate segments. Overlapping strands of these intermediate products hybridize at this 3′ region in a subsequent PCR and are extended to generate the full-length chimeric gene product amplified by flanking primers ovpcr-a and ovpcr-f (Table 1). PCR was initiated by a hot-start procedure and reaction mixture containing all other reagents except Pfu polymerase (Stratagene) was heated at 94°C for 10 sec, then brought to an 80°C holding temperature prior to addition of 5.0 U Pfu polymerase. Then cycling proceeded as follows: 94°C 10 sec, 68°C 4 min for 15 cycles; then 94°C 10 sec, 68°C, 4 min plus 15 sec extension period per cycle for further 15 cycles; followed by a 10 min extension at 72°C. A 1.1 kb DNA sequence upstream of the ldh start codon containing the ldh promoter [27] was PCR amplified from genomic DNA of S. mutans UA 140 using the primers ldh-p01 and ldh-p02 (Table 1). The resulting chimeric gene product was then ligated downstream of the lactate dehydrogenase gene (ldh) promoter (Fig. 1A, and a schematic drawing was provided as supporting information).

Bottom Line: Ecliptic pHluorin was functionally displayed on the cell surface of S. mutans as a fusion protein with SpaP.Meanwhile, a non-uniform pH distribution was observed within S. mutans biofilms, reflecting differences in microbial metabolic activity.Based on these findings, the ecliptic pHluorin allows us to investigate in vivo and in situ acid production and distribution by the cariogenic species S. mutans.

View Article: PubMed Central - PubMed

Affiliation: School of Dentistry, University of California Los Angeles, Los Angeles, California, USA.

ABSTRACT
Acidogenicity and aciduricity are the main virulence factors of the cavity-causing bacterium Streptococcus mutans. Monitoring at the individual cell level the temporal and spatial distribution of acid produced by this important oral pathogen is central for our understanding of these key virulence factors especially when S. mutans resides in multi-species microbial communities. In this study, we explored the application of pH-sensitive green fluorescent proteins (pHluorins) to investigate these important features. Ecliptic pHluorin was functionally displayed on the cell surface of S. mutans as a fusion protein with SpaP. The resulting strain (O87) was used to monitor temporal and spatial pH changes in the microenvironment of S. mutans cells under both planktonic and biofilm conditions. Using strain O87, we revealed a rapid pH drop in the microenviroment of S. mutans microcolonies prior to the decrease in the macro-environment pH following sucrose fermentation. Meanwhile, a non-uniform pH distribution was observed within S. mutans biofilms, reflecting differences in microbial metabolic activity. Furthermore, strain O87 was successfully used to monitor the S. mutans acid production profiles within dual- and multispecies oral biofilms. Based on these findings, the ecliptic pHluorin allows us to investigate in vivo and in situ acid production and distribution by the cariogenic species S. mutans.

Show MeSH
Related in: MedlinePlus