Limits...
Conformational co-dependence between Plasmodium berghei LCCL proteins promotes complex formation and stability.

Saeed S, Tremp AZ, Dessens JT - Mol. Biochem. Parasitol. (2012)

Bottom Line: However, GFP-based fluorescence is dramatically reduced without PbLAP1 present, indicating that PbLAP1 and PbLAP3 interact.Moreover, absence of PbLAP1 markedly reduces the half-life of PbLAP3, consistent with a scenario of misfolding.These findings unveil a potential mechanism of conformational interdependence that facilitates assembly and stability of the functional LCCL protein complex.

View Article: PubMed Central - PubMed

Affiliation: Department of Pathogen Molecular Biology, London School of Hygiene & Tropical Medicine, London WC1E 7HT, UK.

Show MeSH

Related in: MedlinePlus

Molecular analyses of the parental parasite lines PbSR-KO and PbLAP3/GFP, and double mutant parasites derived from a PbSR-KO × PbLAP3/GFP genetic cross. (A) PCR diagnostic for the disrupted pblap1 allele (top right panel; primers [CGCGATG ACCCCCAAGAGGGG] and [CGCCTTCACGCTGATGT]); the GFP-tagged pblap3 allele (top left panel; primers [ACAAAGAATTCATGGTTGGTTCGCTAAACT] and [CCTCAAGATAGTTACGAATTTAAC]); the wildtype pblap1 allele (bottom right panel; primers [CATAATATGCATCTAGAACCAACTTTTC] and [AACGGGATCTTCTAGAATTTAATATAAGCGTTTCAAAAAGGTAAATG]); and the wildtype pblap3 allele (bottom left panel; primers [ACGAAGTTATCAGT CGAGGTACCTAGCGGAAACAACAATGTTC] and [CCTCAAGATAGTTACGAATTTAAC]). B) Southern blot analysis of HindIII-digested genomic DNA using a pblap3-specific probe (left panel) and a hdhfr-specific probe (right panel). (C) Schematic diagram showing the structure of the pblap3 alleles in parasite lines PbSR-KO and PbLAP3/GFP. Indicated are the HindIII restriction sites (H), sizes of the predicted HindIII restriction fragments, and regions corresponding to probes used in B (thick lines).
© Copyright Policy
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3473356&req=5

fig0010: Molecular analyses of the parental parasite lines PbSR-KO and PbLAP3/GFP, and double mutant parasites derived from a PbSR-KO × PbLAP3/GFP genetic cross. (A) PCR diagnostic for the disrupted pblap1 allele (top right panel; primers [CGCGATG ACCCCCAAGAGGGG] and [CGCCTTCACGCTGATGT]); the GFP-tagged pblap3 allele (top left panel; primers [ACAAAGAATTCATGGTTGGTTCGCTAAACT] and [CCTCAAGATAGTTACGAATTTAAC]); the wildtype pblap1 allele (bottom right panel; primers [CATAATATGCATCTAGAACCAACTTTTC] and [AACGGGATCTTCTAGAATTTAATATAAGCGTTTCAAAAAGGTAAATG]); and the wildtype pblap3 allele (bottom left panel; primers [ACGAAGTTATCAGT CGAGGTACCTAGCGGAAACAACAATGTTC] and [CCTCAAGATAGTTACGAATTTAAC]). B) Southern blot analysis of HindIII-digested genomic DNA using a pblap3-specific probe (left panel) and a hdhfr-specific probe (right panel). (C) Schematic diagram showing the structure of the pblap3 alleles in parasite lines PbSR-KO and PbLAP3/GFP. Indicated are the HindIII restriction sites (H), sizes of the predicted HindIII restriction fragments, and regions corresponding to probes used in B (thick lines).

Mentions: Another line of evidence that supports a functional relationship between the LCCL protein family members is provided by observations in P. falciparum that PfCCp proteins are co-dependently expressed [14,16]. These studies showed using immunofluorescence and immunoblotting that genetic disruption of a single pfccp gene not only abolishes expression of its cognate gene product as expected, but also reduces or abolishes the expression of other LCCL proteins. Moreover, this process occurs at the protein, but not at the transcript level. It remains unclear what the molecular mechanisms are that underlie this phenomenon. In this study we investigated whether co-dependent expression exists in P. berghei. To this purpose we generated a double mutant parasite line by crossing a structural gene knockout parasite line for PbLAP1 (also known as PbSR; PlasmoDB ID: PBANKA_103520), named PbSR-KO [7], with a mutant parasite line expressing full-length PbLAP3 (PlasmoDB ID: PBANKA_020450) tagged at the carboxy-terminus with GFP, named PbLAP3/GFP [11]. PbSR-KO parasites display the typical mutant phenotype of all the PbLAP proteins, characterised by a loss of sporozoite development and transmission [7]. This parasite line does not exhibit GFP-based fluorescence. By contrast, parasite line PbLAP3/GFP exhibits strong GFP fluorescence in gametocytes and displays a wildtype phenotype throughout the life cycle [11]. The two parasite lines were crossed by culturing ookinetes from mixed gametocyte populations, followed by feeding the resulting ookinetes to Anopheles stephensi vector mosquitoes in membrane feeders. Because the pblap alleles are maternally inherited [9], cross-fertilization events between female gametes of PbLAP3/GFP and male gametes of PbSR-KO parasites should give rise to infective sporozoites. At three weeks post-infection, sporozoites were transmitted to naïve mice by infected mosquito bites, and double mutants containing both of the modified pblap alleles were selected from the resulting patent blood stage infection by drug selection followed by limiting dilution cloning, as described [17]. The presence of the two modified pblap alleles, as well as the absence of the equivalent unmodified alleles, was confirmed by diagnostic PCR. A ca. 1.1 kb fragment specific for the modified pblap1 allele was amplified from the double mutant and parental PbSR-KO parasite line (Fig. 1A). Similarly, a ca. 1.8 kb fragment specific for the modified pblap3 allele was amplified from both the double mutant and parental PbLAP3/GFP parasite line (Fig. 1A). In addition, fragments of ca. 1.4 kb and 0.8 kb diagnostic for the wildtype pblap1 and pblap3 alleles, respectively, were absent from the double mutant parasites (Fig. 1A). The presence of the pblap3::gfp allele in the double mutant was further verified by Southern analysis: a pblap3-specific probe detected a 3.4 kb fragment in HindIII-digested genomic DNA of the PbSR-KO parental line, but a 9.5 kb fragment in the PbLAP3/GFP parental line, as expected (Fig. 1B and C). A 9.5 kb fragment corresponding to the modified pblap3 allele was also detected in the double mutant, while the 3.4 kb fragment corresponding to the wild-type pblap3 allele was absent in this parasite (Fig. 1B). Similarly, a hdhfr-specific probe detected a 9.5 kb fragment in both the PbLAP3/GFP parent and double mutant, and no signal in the PbSR-KO parent, as expected (Fig. 1B and C).


Conformational co-dependence between Plasmodium berghei LCCL proteins promotes complex formation and stability.

Saeed S, Tremp AZ, Dessens JT - Mol. Biochem. Parasitol. (2012)

Molecular analyses of the parental parasite lines PbSR-KO and PbLAP3/GFP, and double mutant parasites derived from a PbSR-KO × PbLAP3/GFP genetic cross. (A) PCR diagnostic for the disrupted pblap1 allele (top right panel; primers [CGCGATG ACCCCCAAGAGGGG] and [CGCCTTCACGCTGATGT]); the GFP-tagged pblap3 allele (top left panel; primers [ACAAAGAATTCATGGTTGGTTCGCTAAACT] and [CCTCAAGATAGTTACGAATTTAAC]); the wildtype pblap1 allele (bottom right panel; primers [CATAATATGCATCTAGAACCAACTTTTC] and [AACGGGATCTTCTAGAATTTAATATAAGCGTTTCAAAAAGGTAAATG]); and the wildtype pblap3 allele (bottom left panel; primers [ACGAAGTTATCAGT CGAGGTACCTAGCGGAAACAACAATGTTC] and [CCTCAAGATAGTTACGAATTTAAC]). B) Southern blot analysis of HindIII-digested genomic DNA using a pblap3-specific probe (left panel) and a hdhfr-specific probe (right panel). (C) Schematic diagram showing the structure of the pblap3 alleles in parasite lines PbSR-KO and PbLAP3/GFP. Indicated are the HindIII restriction sites (H), sizes of the predicted HindIII restriction fragments, and regions corresponding to probes used in B (thick lines).
© Copyright Policy
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3473356&req=5

fig0010: Molecular analyses of the parental parasite lines PbSR-KO and PbLAP3/GFP, and double mutant parasites derived from a PbSR-KO × PbLAP3/GFP genetic cross. (A) PCR diagnostic for the disrupted pblap1 allele (top right panel; primers [CGCGATG ACCCCCAAGAGGGG] and [CGCCTTCACGCTGATGT]); the GFP-tagged pblap3 allele (top left panel; primers [ACAAAGAATTCATGGTTGGTTCGCTAAACT] and [CCTCAAGATAGTTACGAATTTAAC]); the wildtype pblap1 allele (bottom right panel; primers [CATAATATGCATCTAGAACCAACTTTTC] and [AACGGGATCTTCTAGAATTTAATATAAGCGTTTCAAAAAGGTAAATG]); and the wildtype pblap3 allele (bottom left panel; primers [ACGAAGTTATCAGT CGAGGTACCTAGCGGAAACAACAATGTTC] and [CCTCAAGATAGTTACGAATTTAAC]). B) Southern blot analysis of HindIII-digested genomic DNA using a pblap3-specific probe (left panel) and a hdhfr-specific probe (right panel). (C) Schematic diagram showing the structure of the pblap3 alleles in parasite lines PbSR-KO and PbLAP3/GFP. Indicated are the HindIII restriction sites (H), sizes of the predicted HindIII restriction fragments, and regions corresponding to probes used in B (thick lines).
Mentions: Another line of evidence that supports a functional relationship between the LCCL protein family members is provided by observations in P. falciparum that PfCCp proteins are co-dependently expressed [14,16]. These studies showed using immunofluorescence and immunoblotting that genetic disruption of a single pfccp gene not only abolishes expression of its cognate gene product as expected, but also reduces or abolishes the expression of other LCCL proteins. Moreover, this process occurs at the protein, but not at the transcript level. It remains unclear what the molecular mechanisms are that underlie this phenomenon. In this study we investigated whether co-dependent expression exists in P. berghei. To this purpose we generated a double mutant parasite line by crossing a structural gene knockout parasite line for PbLAP1 (also known as PbSR; PlasmoDB ID: PBANKA_103520), named PbSR-KO [7], with a mutant parasite line expressing full-length PbLAP3 (PlasmoDB ID: PBANKA_020450) tagged at the carboxy-terminus with GFP, named PbLAP3/GFP [11]. PbSR-KO parasites display the typical mutant phenotype of all the PbLAP proteins, characterised by a loss of sporozoite development and transmission [7]. This parasite line does not exhibit GFP-based fluorescence. By contrast, parasite line PbLAP3/GFP exhibits strong GFP fluorescence in gametocytes and displays a wildtype phenotype throughout the life cycle [11]. The two parasite lines were crossed by culturing ookinetes from mixed gametocyte populations, followed by feeding the resulting ookinetes to Anopheles stephensi vector mosquitoes in membrane feeders. Because the pblap alleles are maternally inherited [9], cross-fertilization events between female gametes of PbLAP3/GFP and male gametes of PbSR-KO parasites should give rise to infective sporozoites. At three weeks post-infection, sporozoites were transmitted to naïve mice by infected mosquito bites, and double mutants containing both of the modified pblap alleles were selected from the resulting patent blood stage infection by drug selection followed by limiting dilution cloning, as described [17]. The presence of the two modified pblap alleles, as well as the absence of the equivalent unmodified alleles, was confirmed by diagnostic PCR. A ca. 1.1 kb fragment specific for the modified pblap1 allele was amplified from the double mutant and parental PbSR-KO parasite line (Fig. 1A). Similarly, a ca. 1.8 kb fragment specific for the modified pblap3 allele was amplified from both the double mutant and parental PbLAP3/GFP parasite line (Fig. 1A). In addition, fragments of ca. 1.4 kb and 0.8 kb diagnostic for the wildtype pblap1 and pblap3 alleles, respectively, were absent from the double mutant parasites (Fig. 1A). The presence of the pblap3::gfp allele in the double mutant was further verified by Southern analysis: a pblap3-specific probe detected a 3.4 kb fragment in HindIII-digested genomic DNA of the PbSR-KO parental line, but a 9.5 kb fragment in the PbLAP3/GFP parental line, as expected (Fig. 1B and C). A 9.5 kb fragment corresponding to the modified pblap3 allele was also detected in the double mutant, while the 3.4 kb fragment corresponding to the wild-type pblap3 allele was absent in this parasite (Fig. 1B). Similarly, a hdhfr-specific probe detected a 9.5 kb fragment in both the PbLAP3/GFP parent and double mutant, and no signal in the PbSR-KO parent, as expected (Fig. 1B and C).

Bottom Line: However, GFP-based fluorescence is dramatically reduced without PbLAP1 present, indicating that PbLAP1 and PbLAP3 interact.Moreover, absence of PbLAP1 markedly reduces the half-life of PbLAP3, consistent with a scenario of misfolding.These findings unveil a potential mechanism of conformational interdependence that facilitates assembly and stability of the functional LCCL protein complex.

View Article: PubMed Central - PubMed

Affiliation: Department of Pathogen Molecular Biology, London School of Hygiene & Tropical Medicine, London WC1E 7HT, UK.

Show MeSH
Related in: MedlinePlus