Limits...
A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.).

Tanaka Y, Tsuda M, Yasumoto K, Yamagishi H, Terachi T - BMC Genomics (2012)

Bottom Line: Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size) that are non-syntenic to normal-type genome, and the gene orf138 was found to be located at the edge of the largest unique region.Blast analysis performed to assign the unique regions showed that about 80% of the region was covered by short homologous sequences to the mitochondrial sequences of normal-type radish or other reported Brassicaceae species, although no homology was found for the remaining 20% of sequences.Ogura-type mitochondrial genome was highly rearranged compared with the normal-type genome by recombination through one large repeat and multiple short repeats.

View Article: PubMed Central - HTML - PubMed

Affiliation: 31 Laboratory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555, Japan. terachi@cc.kyoto-su.ac.jp

ABSTRACT

Background: Plant mitochondrial genome has unique features such as large size, frequent recombination and incorporation of foreign DNA. Cytoplasmic male sterility (CMS) is caused by rearrangement of the mitochondrial genome, and a novel chimeric open reading frame (ORF) created by shuffling of endogenous sequences is often responsible for CMS. The Ogura-type male-sterile cytoplasm is one of the most extensively studied cytoplasms in Brassicaceae. Although the gene orf138 has been isolated as a determinant of Ogura-type CMS, no homologous sequence to orf138 has been found in public databases. Therefore, how orf138 sequence was created is a mystery. In this study, we determined the complete nucleotide sequence of two radish mitochondrial genomes, namely, Ogura- and normal-type genomes, and analyzed them to reveal the origin of the gene orf138.

Results: Ogura- and normal-type mitochondrial genomes were assembled to 258,426-bp and 244,036-bp circular sequences, respectively. Normal-type mitochondrial genome contained 33 protein-coding and three rRNA genes, which are well conserved with the reported mitochondrial genome of rapeseed. Ogura-type genomes contained same genes and additional atp9. As for tRNA, normal-type contained 17 tRNAs, while Ogura-type contained 17 tRNAs and one additional trnfM. The gene orf138 was specific to Ogura-type mitochondrial genome, and no sequence homologous to it was found in normal-type genome. Comparative analysis of the two genomes revealed that radish mitochondrial genome consists of 11 syntenic regions (length >3 kb, similarity >99.9%). It was shown that short repeats and overlapped repeats present in the edge of syntenic regions were involved in recombination events during evolution to interconvert two types of mitochondrial genome. Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size) that are non-syntenic to normal-type genome, and the gene orf138 was found to be located at the edge of the largest unique region. Blast analysis performed to assign the unique regions showed that about 80% of the region was covered by short homologous sequences to the mitochondrial sequences of normal-type radish or other reported Brassicaceae species, although no homology was found for the remaining 20% of sequences.

Conclusions: Ogura-type mitochondrial genome was highly rearranged compared with the normal-type genome by recombination through one large repeat and multiple short repeats. The rearrangement has produced four unique regions in Ogura-type mitochondrial genome, and most of the unique regions are composed of known Brassicaceae mitochondrial sequences. This suggests that the regions unique to the Ogura-type genome were generated by integration and shuffling of pre-existing mitochondrial sequences during the evolution of Brassicaceae, and novel genes such as orf138 could have been created by the shuffling process of mitochondrial genome.

Show MeSH

Related in: MedlinePlus

An atp8 promoter sequence affected by rearrangement among syntenic regions. Alignment of nucleotide sequences shows the comparison of predicted promoters for the gene atp8 among three mitochondrial genomes including Arabidopsis, and Ogura and normal radish. In Ogura-type genome, a promoter core (in a dotted box) is lost. This nucleotide change can affect transcription of the gene atp8.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3473294&req=5

Figure 6: An atp8 promoter sequence affected by rearrangement among syntenic regions. Alignment of nucleotide sequences shows the comparison of predicted promoters for the gene atp8 among three mitochondrial genomes including Arabidopsis, and Ogura and normal radish. In Ogura-type genome, a promoter core (in a dotted box) is lost. This nucleotide change can affect transcription of the gene atp8.

Mentions: Previously, we conducted sequence analysis on the atp8 locus in normal- and Ogura-type cytoplasm from wild and cultivated radishes [36]. While plants with normal-type cytoplasm contained several types of sequence, plants with Ogura-type cytoplasm had only one type of sequence. These results suggested that a mutational event, which created linkage of atp8 and orf138, occurred only once in the history of radish [36]. The present data indicate that this event probably occurred at the same time as when recombination between syntenic regions 7 and 11 occurred via 176-bp repeats and the unique region IV was integrated into the Ogura-type mitochondrial genome (Figure 5). Interestingly, the radish mitochondrial genome may have lost one putative promoter region for atp8 by this recombination (Figure 6). In Arabidopsis, the promoters of mitochondrial genes have been determined [37]. A promoter sequence of atp8 (CTATCAATCTCATAAGAGAAGAAAT) is almost conserved at the edge of syntenic region 11 of normal radish. The position of the promoter exactly matched the size of atp8 transcript (ca. 600 bp in size) [16]. The recombination of syntenic regions 7 and 11 would destroy the promoter sequence. Therefore, recombination between syntenic regions 7 and 11 in normal radish can lead to loss of biological function in mitochondria. A reasonable hypothesis to explain the generation of Ogura-type mitochondrial genome is that the mitochondrial genome rearrangement that could compensate for the loss of biological function had been selected among many rearranged genomes. Integration of unique region IV can provide a new promoter for the gene atp8. Actually, in Ogura-type genome, atp8 is co-transcribed with orf138 and trnfM, while in normal-type, atp8 is transcribed from its own promoter.


A complete mitochondrial genome sequence of Ogura-type male-sterile cytoplasm and its comparative analysis with that of normal cytoplasm in radish (Raphanus sativus L.).

Tanaka Y, Tsuda M, Yasumoto K, Yamagishi H, Terachi T - BMC Genomics (2012)

An atp8 promoter sequence affected by rearrangement among syntenic regions. Alignment of nucleotide sequences shows the comparison of predicted promoters for the gene atp8 among three mitochondrial genomes including Arabidopsis, and Ogura and normal radish. In Ogura-type genome, a promoter core (in a dotted box) is lost. This nucleotide change can affect transcription of the gene atp8.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3473294&req=5

Figure 6: An atp8 promoter sequence affected by rearrangement among syntenic regions. Alignment of nucleotide sequences shows the comparison of predicted promoters for the gene atp8 among three mitochondrial genomes including Arabidopsis, and Ogura and normal radish. In Ogura-type genome, a promoter core (in a dotted box) is lost. This nucleotide change can affect transcription of the gene atp8.
Mentions: Previously, we conducted sequence analysis on the atp8 locus in normal- and Ogura-type cytoplasm from wild and cultivated radishes [36]. While plants with normal-type cytoplasm contained several types of sequence, plants with Ogura-type cytoplasm had only one type of sequence. These results suggested that a mutational event, which created linkage of atp8 and orf138, occurred only once in the history of radish [36]. The present data indicate that this event probably occurred at the same time as when recombination between syntenic regions 7 and 11 occurred via 176-bp repeats and the unique region IV was integrated into the Ogura-type mitochondrial genome (Figure 5). Interestingly, the radish mitochondrial genome may have lost one putative promoter region for atp8 by this recombination (Figure 6). In Arabidopsis, the promoters of mitochondrial genes have been determined [37]. A promoter sequence of atp8 (CTATCAATCTCATAAGAGAAGAAAT) is almost conserved at the edge of syntenic region 11 of normal radish. The position of the promoter exactly matched the size of atp8 transcript (ca. 600 bp in size) [16]. The recombination of syntenic regions 7 and 11 would destroy the promoter sequence. Therefore, recombination between syntenic regions 7 and 11 in normal radish can lead to loss of biological function in mitochondria. A reasonable hypothesis to explain the generation of Ogura-type mitochondrial genome is that the mitochondrial genome rearrangement that could compensate for the loss of biological function had been selected among many rearranged genomes. Integration of unique region IV can provide a new promoter for the gene atp8. Actually, in Ogura-type genome, atp8 is co-transcribed with orf138 and trnfM, while in normal-type, atp8 is transcribed from its own promoter.

Bottom Line: Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size) that are non-syntenic to normal-type genome, and the gene orf138 was found to be located at the edge of the largest unique region.Blast analysis performed to assign the unique regions showed that about 80% of the region was covered by short homologous sequences to the mitochondrial sequences of normal-type radish or other reported Brassicaceae species, although no homology was found for the remaining 20% of sequences.Ogura-type mitochondrial genome was highly rearranged compared with the normal-type genome by recombination through one large repeat and multiple short repeats.

View Article: PubMed Central - HTML - PubMed

Affiliation: 31 Laboratory, Kyoto Sangyo University, Motoyama, Kamigamo, Kita-ku, Kyoto 603-8555, Japan. terachi@cc.kyoto-su.ac.jp

ABSTRACT

Background: Plant mitochondrial genome has unique features such as large size, frequent recombination and incorporation of foreign DNA. Cytoplasmic male sterility (CMS) is caused by rearrangement of the mitochondrial genome, and a novel chimeric open reading frame (ORF) created by shuffling of endogenous sequences is often responsible for CMS. The Ogura-type male-sterile cytoplasm is one of the most extensively studied cytoplasms in Brassicaceae. Although the gene orf138 has been isolated as a determinant of Ogura-type CMS, no homologous sequence to orf138 has been found in public databases. Therefore, how orf138 sequence was created is a mystery. In this study, we determined the complete nucleotide sequence of two radish mitochondrial genomes, namely, Ogura- and normal-type genomes, and analyzed them to reveal the origin of the gene orf138.

Results: Ogura- and normal-type mitochondrial genomes were assembled to 258,426-bp and 244,036-bp circular sequences, respectively. Normal-type mitochondrial genome contained 33 protein-coding and three rRNA genes, which are well conserved with the reported mitochondrial genome of rapeseed. Ogura-type genomes contained same genes and additional atp9. As for tRNA, normal-type contained 17 tRNAs, while Ogura-type contained 17 tRNAs and one additional trnfM. The gene orf138 was specific to Ogura-type mitochondrial genome, and no sequence homologous to it was found in normal-type genome. Comparative analysis of the two genomes revealed that radish mitochondrial genome consists of 11 syntenic regions (length >3 kb, similarity >99.9%). It was shown that short repeats and overlapped repeats present in the edge of syntenic regions were involved in recombination events during evolution to interconvert two types of mitochondrial genome. Ogura-type mitochondrial genome has four unique regions (2,803 bp, 1,601 bp, 451 bp and 15,255 bp in size) that are non-syntenic to normal-type genome, and the gene orf138 was found to be located at the edge of the largest unique region. Blast analysis performed to assign the unique regions showed that about 80% of the region was covered by short homologous sequences to the mitochondrial sequences of normal-type radish or other reported Brassicaceae species, although no homology was found for the remaining 20% of sequences.

Conclusions: Ogura-type mitochondrial genome was highly rearranged compared with the normal-type genome by recombination through one large repeat and multiple short repeats. The rearrangement has produced four unique regions in Ogura-type mitochondrial genome, and most of the unique regions are composed of known Brassicaceae mitochondrial sequences. This suggests that the regions unique to the Ogura-type genome were generated by integration and shuffling of pre-existing mitochondrial sequences during the evolution of Brassicaceae, and novel genes such as orf138 could have been created by the shuffling process of mitochondrial genome.

Show MeSH
Related in: MedlinePlus