Limits...
Fine mapping and conditional analysis identify a new mutation in the autoimmunity susceptibility gene BLK that leads to reduced half-life of the BLK protein.

Delgado-Vega AM, Dozmorov MG, Quirós MB, Wu YY, Martínez-García B, Kozyrev SV, Frostegård J, Truedsson L, de Ramón E, González-Escribano MF, Ortego-Centeno N, Pons-Estel BA, D'Alfonso S, Sebastiani GD, Witte T, Lauwerys BR, Endreffy E, Kovács L, Vasconcelos C, da Silva BM, Wren JD, Martin J, Castillejo-López C, Alarcón-Riquelme ME - Ann. Rheum. Dis. (2012)

Bottom Line: Fine mapping of BLK identified two independent genetic effects with functional consequences: one represented by two tightly linked associated haplotype blocks significantly enriched for NFκB-binding sites and numerous putative regulatory variants whose risk alleles correlated with low BLK mRNA levels.The 71Thr decreased BLK protein half-life.These results show that rare and common regulatory variants in BLK are involved in disease susceptibility and both, albeit independently, lead to reduced levels of BLK protein.

View Article: PubMed Central - PubMed

Affiliation: Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, 751 85, Sweden.

ABSTRACT

Objectives: To perform fine mapping of the autoimmunity susceptibility gene BLK and identify functional variants involved in systemic lupus erythematosus (SLE).

Methods: Genotyping of 1163 European SLE patients and 1482 controls and imputation were performed covering the BLK gene with 158 single-nucleotide polymorphisms. Logistic regression analysis was done using PLINK and conditional analyses using GENABEL's test score. Transfections of BLK constructs on HEK293 cells containing the novel mutation or the wild type form were analysed for their effect on protein half-life using a protein stability assay, cycloheximide and western blot. CHiP-qPCR for detection of nuclear factor κ B (NFkB) binding.

Results: Fine mapping of BLK identified two independent genetic effects with functional consequences: one represented by two tightly linked associated haplotype blocks significantly enriched for NFκB-binding sites and numerous putative regulatory variants whose risk alleles correlated with low BLK mRNA levels. Binding of NFkBp50 and p65 to an associated 1.2 Kb haplotype segment was confirmed. A second independent genetic effect was represented by an Ala71Thr, low-frequency missense substitution with an OR=2.31 (95% CI 1.38 to 3.86). The 71Thr decreased BLK protein half-life.

Conclusions: These results show that rare and common regulatory variants in BLK are involved in disease susceptibility and both, albeit independently, lead to reduced levels of BLK protein.

Show MeSH

Related in: MedlinePlus

Genotyping of the Ala71Thr substitution in exon 4 of BLK. (A) Schematic diagrams showing the procedure for genotyping the single-nucleotide polymorphism (SNP) rs55758736 in exon 4 of BLK. Genomic DNA was amplified with primers flanking exon 4 (In3-F: 5′AGAAGCCTGTCCTCCTTGGTAGC 3′ and In4-R: 5′GGAAAGATTTTGGAGAGGAAGACA 3′) and the PCR products were digested with the restriction enzyme AciI. The A allele disrupts the restriction site generating only two fragments of 48 and 322 bp while the G allele produces three fragments of 48, 80 and 242 bp. (B) PCR products of four subjects showing a unique band of 370 bp and (C) the subsequent AciI digestion of the amplification products. Subjects 2 and 3 are heterozygotes (G/A) and subjects 1 and 4 are homozygotes for the wild type allele (G/G). (D) Sequence chromatographs showing one subject heterozygous for the BLK mutation (above) and one subject homozygous for the wild type allele (below).
© Copyright Policy - open-access
Related In: Results  -  Collection

License 1 - License 2
getmorefigures.php?uid=PMC3375585&req=5

Figure 4: Genotyping of the Ala71Thr substitution in exon 4 of BLK. (A) Schematic diagrams showing the procedure for genotyping the single-nucleotide polymorphism (SNP) rs55758736 in exon 4 of BLK. Genomic DNA was amplified with primers flanking exon 4 (In3-F: 5′AGAAGCCTGTCCTCCTTGGTAGC 3′ and In4-R: 5′GGAAAGATTTTGGAGAGGAAGACA 3′) and the PCR products were digested with the restriction enzyme AciI. The A allele disrupts the restriction site generating only two fragments of 48 and 322 bp while the G allele produces three fragments of 48, 80 and 242 bp. (B) PCR products of four subjects showing a unique band of 370 bp and (C) the subsequent AciI digestion of the amplification products. Subjects 2 and 3 are heterozygotes (G/A) and subjects 1 and 4 are homozygotes for the wild type allele (G/G). (D) Sequence chromatographs showing one subject heterozygous for the BLK mutation (above) and one subject homozygous for the wild type allele (below).

Mentions: The independent Ala71Thr substitution is located on the SH3 (Src homology 3) domain of the BLK protein, which is of importance in protein–protein interactions. The SIFT algorithm2526 predicted this substitution to be potentially damaging. As rs55758736 was identified through imputation, we verified the presence of the mutation in 178 selected samples of cases and controls. Of these, we genotyped all of those individuals predicted by imputation to have the mutation and a group of individuals predicted not to have it. Verification was done using PCR, RFLP and sequencing (figure 4) reaching 92% concordance. The mutation was observed in 2.17% of SLE patients and 0.92% of controls, all in the heterozygous state (OR=2.31; 95% CI 1.38 to 3.86 with the Pearson's goodness-of-fitχ2 (df=1)). Adding 1103 new controls, the OR was adjusted to 1.79 (95% CI 1.15 to 2.51).


Fine mapping and conditional analysis identify a new mutation in the autoimmunity susceptibility gene BLK that leads to reduced half-life of the BLK protein.

Delgado-Vega AM, Dozmorov MG, Quirós MB, Wu YY, Martínez-García B, Kozyrev SV, Frostegård J, Truedsson L, de Ramón E, González-Escribano MF, Ortego-Centeno N, Pons-Estel BA, D'Alfonso S, Sebastiani GD, Witte T, Lauwerys BR, Endreffy E, Kovács L, Vasconcelos C, da Silva BM, Wren JD, Martin J, Castillejo-López C, Alarcón-Riquelme ME - Ann. Rheum. Dis. (2012)

Genotyping of the Ala71Thr substitution in exon 4 of BLK. (A) Schematic diagrams showing the procedure for genotyping the single-nucleotide polymorphism (SNP) rs55758736 in exon 4 of BLK. Genomic DNA was amplified with primers flanking exon 4 (In3-F: 5′AGAAGCCTGTCCTCCTTGGTAGC 3′ and In4-R: 5′GGAAAGATTTTGGAGAGGAAGACA 3′) and the PCR products were digested with the restriction enzyme AciI. The A allele disrupts the restriction site generating only two fragments of 48 and 322 bp while the G allele produces three fragments of 48, 80 and 242 bp. (B) PCR products of four subjects showing a unique band of 370 bp and (C) the subsequent AciI digestion of the amplification products. Subjects 2 and 3 are heterozygotes (G/A) and subjects 1 and 4 are homozygotes for the wild type allele (G/G). (D) Sequence chromatographs showing one subject heterozygous for the BLK mutation (above) and one subject homozygous for the wild type allele (below).
© Copyright Policy - open-access
Related In: Results  -  Collection

License 1 - License 2
Show All Figures
getmorefigures.php?uid=PMC3375585&req=5

Figure 4: Genotyping of the Ala71Thr substitution in exon 4 of BLK. (A) Schematic diagrams showing the procedure for genotyping the single-nucleotide polymorphism (SNP) rs55758736 in exon 4 of BLK. Genomic DNA was amplified with primers flanking exon 4 (In3-F: 5′AGAAGCCTGTCCTCCTTGGTAGC 3′ and In4-R: 5′GGAAAGATTTTGGAGAGGAAGACA 3′) and the PCR products were digested with the restriction enzyme AciI. The A allele disrupts the restriction site generating only two fragments of 48 and 322 bp while the G allele produces three fragments of 48, 80 and 242 bp. (B) PCR products of four subjects showing a unique band of 370 bp and (C) the subsequent AciI digestion of the amplification products. Subjects 2 and 3 are heterozygotes (G/A) and subjects 1 and 4 are homozygotes for the wild type allele (G/G). (D) Sequence chromatographs showing one subject heterozygous for the BLK mutation (above) and one subject homozygous for the wild type allele (below).
Mentions: The independent Ala71Thr substitution is located on the SH3 (Src homology 3) domain of the BLK protein, which is of importance in protein–protein interactions. The SIFT algorithm2526 predicted this substitution to be potentially damaging. As rs55758736 was identified through imputation, we verified the presence of the mutation in 178 selected samples of cases and controls. Of these, we genotyped all of those individuals predicted by imputation to have the mutation and a group of individuals predicted not to have it. Verification was done using PCR, RFLP and sequencing (figure 4) reaching 92% concordance. The mutation was observed in 2.17% of SLE patients and 0.92% of controls, all in the heterozygous state (OR=2.31; 95% CI 1.38 to 3.86 with the Pearson's goodness-of-fitχ2 (df=1)). Adding 1103 new controls, the OR was adjusted to 1.79 (95% CI 1.15 to 2.51).

Bottom Line: Fine mapping of BLK identified two independent genetic effects with functional consequences: one represented by two tightly linked associated haplotype blocks significantly enriched for NFκB-binding sites and numerous putative regulatory variants whose risk alleles correlated with low BLK mRNA levels.The 71Thr decreased BLK protein half-life.These results show that rare and common regulatory variants in BLK are involved in disease susceptibility and both, albeit independently, lead to reduced levels of BLK protein.

View Article: PubMed Central - PubMed

Affiliation: Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, 751 85, Sweden.

ABSTRACT

Objectives: To perform fine mapping of the autoimmunity susceptibility gene BLK and identify functional variants involved in systemic lupus erythematosus (SLE).

Methods: Genotyping of 1163 European SLE patients and 1482 controls and imputation were performed covering the BLK gene with 158 single-nucleotide polymorphisms. Logistic regression analysis was done using PLINK and conditional analyses using GENABEL's test score. Transfections of BLK constructs on HEK293 cells containing the novel mutation or the wild type form were analysed for their effect on protein half-life using a protein stability assay, cycloheximide and western blot. CHiP-qPCR for detection of nuclear factor κ B (NFkB) binding.

Results: Fine mapping of BLK identified two independent genetic effects with functional consequences: one represented by two tightly linked associated haplotype blocks significantly enriched for NFκB-binding sites and numerous putative regulatory variants whose risk alleles correlated with low BLK mRNA levels. Binding of NFkBp50 and p65 to an associated 1.2 Kb haplotype segment was confirmed. A second independent genetic effect was represented by an Ala71Thr, low-frequency missense substitution with an OR=2.31 (95% CI 1.38 to 3.86). The 71Thr decreased BLK protein half-life.

Conclusions: These results show that rare and common regulatory variants in BLK are involved in disease susceptibility and both, albeit independently, lead to reduced levels of BLK protein.

Show MeSH
Related in: MedlinePlus