Limits...
A comparative study of nemertean complete mitochondrial genomes, including two new ones for Nectonemertes cf. mirabilis and Zygeupolia rubens, may elucidate the fundamental pattern for the phylum Nemertea.

Chen HX, Sun SC, Sundberg P, Ren WC, Norenburg JL - BMC Genomics (2012)

Bottom Line: The AT-rich non-coding regions of the two genomes have some repeat sequences and stem-loop structures, both of which may be associated with the initiation of replication or transcription.Gene order comparison to the proposed ground pattern of Bilateria and some lophotrochozoans suggests that the nemertean ancestral mitochondrial gene order most closely resembles the heteronemertean type.Phylogenetic analysis proposes a sister-group relationship between Hetero- and Hoplonemertea, which supports one of two recent alternative hypotheses of nemertean phylogeny.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Biological and Environmental Sciences, University ofGothenburg, PO Box 463, SE-405 30 Gothenburg, Sweden.

ABSTRACT

Background: The mitochondrial genome is important for studying genome evolution as well as reconstructing the phylogeny of organisms. Complete mitochondrial genome sequences have been reported for more than 2200 metazoans, mainly vertebrates and arthropods. To date, from a total of about 1275 described nemertean species, only three complete and two partial mitochondrial DNA sequences from nemerteans have been published. Here, we report the entire mitochondrial genomes for two more nemertean species: Nectonemertes cf. mirabilis and Zygeupolia rubens.

Results: The sizes of the entire mitochondrial genomes are 15365 bp for N. cf. mirabilis and 15513 bp for Z. rubens. Each circular genome contains 37 genes and an AT-rich non-coding region, and overall nucleotide composition is AT-rich. In both species, there is significant strand asymmetry in the distribution of nucleotides, with the coding strand being richer in T than A and in G than C. The AT-rich non-coding regions of the two genomes have some repeat sequences and stem-loop structures, both of which may be associated with the initiation of replication or transcription. The 22 tRNAs show variable substitution patterns in nemerteans, with higher sequence conservation in genes located on the H strand. Gene arrangement of N. cf. mirabilis is identical to that of Paranemertes cf. peregrina, both of which are Hoplonemertea, while that of Z. rubens is the same as in Lineus viridis, both of which are Heteronemertea. Comparison of the gene arrangements and phylogenomic analysis based on concatenated nucleotide sequences of the 12 mitochondrial protein-coding genes revealed that species with closer relationships share more identical gene blocks.

Conclusion: The two new mitochondrial genomes share many features, including gene contents, with other known nemertean mitochondrial genomes. The tRNA families display a composite substitution pathway. Gene order comparison to the proposed ground pattern of Bilateria and some lophotrochozoans suggests that the nemertean ancestral mitochondrial gene order most closely resembles the heteronemertean type. Phylogenetic analysis proposes a sister-group relationship between Hetero- and Hoplonemertea, which supports one of two recent alternative hypotheses of nemertean phylogeny.

Show MeSH
Secondary structures predicted for the non-coding regions in the mitochondrial genome of two nemerteans. (A) Nectonemertes cf. mirabilis, AT-rich non-coding region between genes trnW and trnS2; (B, C) Zygeupolia rubens, AT-rich non-coding region between genes nad3 and trnS2.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3368773&req=5

Figure 7: Secondary structures predicted for the non-coding regions in the mitochondrial genome of two nemerteans. (A) Nectonemertes cf. mirabilis, AT-rich non-coding region between genes trnW and trnS2; (B, C) Zygeupolia rubens, AT-rich non-coding region between genes nad3 and trnS2.

Mentions: In most metazoan mtDNAs, the largest non-coding region is thought to contain signals for replication and transcription, and is thus referred to as the control region [11]. The non-coding region has an increased AT composition, a characteristic typically used to identify origins of replication [10]. As in mtDNA genomes of other nemerteans, the AT-rich regions of N. cf. mirabilis and Z. rubens mtDNAs have the potential to form secondary structures such as stems and loops (Figure 7), which are thought to play an important role in the early stages of the replication and transcription process [34,35]. Additionally, the AT-rich region in mtDNA of N. cf. mirabilis contains the tandemly repeated sequences (AAAAATATAAGATTTTTCAAATTCCAAAAATATAAAAT)3, (TTTTG)10, (TTTTTC)7, and several (A)n and (T)n homopolymer tracts. In mtDNAs of Z. rubens, we found the tandemly repeated sequences (GGGGGGGGGGGTAGTGTGGTTATGTTTTACTACACTCTTAGTAAAATATAAA)2, (TTTTTTG)10, and (TTTTTTTTA)6. Similar tandem repeat units within the largest non-coding regions also were found in the nemerteans Cephalothrix sp. [8], and C. hongkongiensis [6]. Tandem repeats are common within the control region of animal mtDNAs [34] and might be associated with regulatory mechanisms and recombination hot spots, and they might be the result of replication slippage events [36]. The high AT content and the predicted secondary structures of the AT-rich non-coding region of the N. cf. mirabilis and Z. rubens mtDNAs suggest that this region most likely contains the control region, though the control region in invertebrates, unlike that of vertebrates, is not well characterized and lacks discrete and conserved sequence blocks used in identification [37]. The nemertean mtDNA sequences examined here had multiple non-coding regions throughout their genomes. However, the location of the largest non-coding region is not conserved, and there is no obvious conservation of size (e.g., [6,8]), nucleotide identities or potential secondary structures for the nemertean non-coding regions.


A comparative study of nemertean complete mitochondrial genomes, including two new ones for Nectonemertes cf. mirabilis and Zygeupolia rubens, may elucidate the fundamental pattern for the phylum Nemertea.

Chen HX, Sun SC, Sundberg P, Ren WC, Norenburg JL - BMC Genomics (2012)

Secondary structures predicted for the non-coding regions in the mitochondrial genome of two nemerteans. (A) Nectonemertes cf. mirabilis, AT-rich non-coding region between genes trnW and trnS2; (B, C) Zygeupolia rubens, AT-rich non-coding region between genes nad3 and trnS2.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3368773&req=5

Figure 7: Secondary structures predicted for the non-coding regions in the mitochondrial genome of two nemerteans. (A) Nectonemertes cf. mirabilis, AT-rich non-coding region between genes trnW and trnS2; (B, C) Zygeupolia rubens, AT-rich non-coding region between genes nad3 and trnS2.
Mentions: In most metazoan mtDNAs, the largest non-coding region is thought to contain signals for replication and transcription, and is thus referred to as the control region [11]. The non-coding region has an increased AT composition, a characteristic typically used to identify origins of replication [10]. As in mtDNA genomes of other nemerteans, the AT-rich regions of N. cf. mirabilis and Z. rubens mtDNAs have the potential to form secondary structures such as stems and loops (Figure 7), which are thought to play an important role in the early stages of the replication and transcription process [34,35]. Additionally, the AT-rich region in mtDNA of N. cf. mirabilis contains the tandemly repeated sequences (AAAAATATAAGATTTTTCAAATTCCAAAAATATAAAAT)3, (TTTTG)10, (TTTTTC)7, and several (A)n and (T)n homopolymer tracts. In mtDNAs of Z. rubens, we found the tandemly repeated sequences (GGGGGGGGGGGTAGTGTGGTTATGTTTTACTACACTCTTAGTAAAATATAAA)2, (TTTTTTG)10, and (TTTTTTTTA)6. Similar tandem repeat units within the largest non-coding regions also were found in the nemerteans Cephalothrix sp. [8], and C. hongkongiensis [6]. Tandem repeats are common within the control region of animal mtDNAs [34] and might be associated with regulatory mechanisms and recombination hot spots, and they might be the result of replication slippage events [36]. The high AT content and the predicted secondary structures of the AT-rich non-coding region of the N. cf. mirabilis and Z. rubens mtDNAs suggest that this region most likely contains the control region, though the control region in invertebrates, unlike that of vertebrates, is not well characterized and lacks discrete and conserved sequence blocks used in identification [37]. The nemertean mtDNA sequences examined here had multiple non-coding regions throughout their genomes. However, the location of the largest non-coding region is not conserved, and there is no obvious conservation of size (e.g., [6,8]), nucleotide identities or potential secondary structures for the nemertean non-coding regions.

Bottom Line: The AT-rich non-coding regions of the two genomes have some repeat sequences and stem-loop structures, both of which may be associated with the initiation of replication or transcription.Gene order comparison to the proposed ground pattern of Bilateria and some lophotrochozoans suggests that the nemertean ancestral mitochondrial gene order most closely resembles the heteronemertean type.Phylogenetic analysis proposes a sister-group relationship between Hetero- and Hoplonemertea, which supports one of two recent alternative hypotheses of nemertean phylogeny.

View Article: PubMed Central - HTML - PubMed

Affiliation: Department of Biological and Environmental Sciences, University ofGothenburg, PO Box 463, SE-405 30 Gothenburg, Sweden.

ABSTRACT

Background: The mitochondrial genome is important for studying genome evolution as well as reconstructing the phylogeny of organisms. Complete mitochondrial genome sequences have been reported for more than 2200 metazoans, mainly vertebrates and arthropods. To date, from a total of about 1275 described nemertean species, only three complete and two partial mitochondrial DNA sequences from nemerteans have been published. Here, we report the entire mitochondrial genomes for two more nemertean species: Nectonemertes cf. mirabilis and Zygeupolia rubens.

Results: The sizes of the entire mitochondrial genomes are 15365 bp for N. cf. mirabilis and 15513 bp for Z. rubens. Each circular genome contains 37 genes and an AT-rich non-coding region, and overall nucleotide composition is AT-rich. In both species, there is significant strand asymmetry in the distribution of nucleotides, with the coding strand being richer in T than A and in G than C. The AT-rich non-coding regions of the two genomes have some repeat sequences and stem-loop structures, both of which may be associated with the initiation of replication or transcription. The 22 tRNAs show variable substitution patterns in nemerteans, with higher sequence conservation in genes located on the H strand. Gene arrangement of N. cf. mirabilis is identical to that of Paranemertes cf. peregrina, both of which are Hoplonemertea, while that of Z. rubens is the same as in Lineus viridis, both of which are Heteronemertea. Comparison of the gene arrangements and phylogenomic analysis based on concatenated nucleotide sequences of the 12 mitochondrial protein-coding genes revealed that species with closer relationships share more identical gene blocks.

Conclusion: The two new mitochondrial genomes share many features, including gene contents, with other known nemertean mitochondrial genomes. The tRNA families display a composite substitution pathway. Gene order comparison to the proposed ground pattern of Bilateria and some lophotrochozoans suggests that the nemertean ancestral mitochondrial gene order most closely resembles the heteronemertean type. Phylogenetic analysis proposes a sister-group relationship between Hetero- and Hoplonemertea, which supports one of two recent alternative hypotheses of nemertean phylogeny.

Show MeSH