Limits...
Permanent or reversible conjugation of 2'-O- or 5'-O-aminooxymethylated nucleosides with functional groups as a convenient and efficient approach to the modification of RNA and DNA sequences.

Cieslak J, Grajkowski A, Ausín C, Gapeev A, Beaucage SL - Nucleic Acids Res. (2011)

Bottom Line: The reaction of these novel ribonucleosides with 1-pyrenecarboxaldehyde results in the efficient formation of stable and yet reversible ribonucleoside 2'-conjugates in yields of 69-82%.Although the versatility and uniqueness of 2'-O-aminooxymethyl ribonucleosides in the preparation of modified RNA sequences is demonstrated by the single or double incorporation of a reversible pyrenylated uridine 2'-conjugate into an RNA sequence, the conjugation of 2'-O-aminooxymethyl ribonucleosides with aldehydes, including those generated from their acetals, provides reversible 2'-O-protected ribonucleosides for potential applications in the solid-phase synthesis of native RNA sequences.The synthesis of a chimeric polyuridylic acid is presented as an exemplary model.

View Article: PubMed Central - PubMed

Affiliation: Division of Therapeutic Proteins, Center for Drug Evaluation and Research, Food and Drug Administration, 8800 Rockville Pike, Bethesda, MD 20892, USA.

ABSTRACT
2'-O-Aminooxymethyl ribonucleosides are prepared from their 3',5'-disilylated 2'-O-phthalimidooxymethyl derivatives by treatment with NH(4)F in MeOH. The reaction of these novel ribonucleosides with 1-pyrenecarboxaldehyde results in the efficient formation of stable and yet reversible ribonucleoside 2'-conjugates in yields of 69-82%. Indeed, exposure of these conjugates to 0.5 M tetra-n-butylammonium fluoride (TBAF) in THF results in the cleavage of their iminoether functions to give the native ribonucleosides along with the innocuous nitrile side product. Conversely, the reaction of 5-cholesten-3-one or dansyl chloride with 2'-O-aminooxymethyl uridine provides permanent uridine 2'-conjugates, which are left essentially intact upon treatment with TBAF. Alternatively, 5'-O-aminooxymethyl thymidine is prepared by hydrazinolysis of its 3'-O-levulinyl-5'-O-phthalimidooxymethyl precursor. Pyrenylation of 5'-O-aminooxymethyl thymidine and the sensitivity of the 5'-conjugate to TBAF further exemplify the usefulness of this nucleoside for modifying DNA sequences either permanently or reversibly. Although the versatility and uniqueness of 2'-O-aminooxymethyl ribonucleosides in the preparation of modified RNA sequences is demonstrated by the single or double incorporation of a reversible pyrenylated uridine 2'-conjugate into an RNA sequence, the conjugation of 2'-O-aminooxymethyl ribonucleosides with aldehydes, including those generated from their acetals, provides reversible 2'-O-protected ribonucleosides for potential applications in the solid-phase synthesis of native RNA sequences. The synthesis of a chimeric polyuridylic acid is presented as an exemplary model.

Show MeSH

Related in: MedlinePlus

RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCUAACGUCAUG)dT (31) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 31 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 31 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed using UV detection (254 nm) and a 5 μm Supelcosil LC-18S column (25 cm × 4.6 mm) according to the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min and was then held, isocratically, for 20 min. Peak heights are normalized to the highest peak, which is set to 1 AU.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3300013&req=5

gkr896-F4: RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCUAACGUCAUG)dT (31) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 31 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 31 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed using UV detection (254 nm) and a 5 μm Supelcosil LC-18S column (25 cm × 4.6 mm) according to the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min and was then held, isocratically, for 20 min. Peak heights are normalized to the highest peak, which is set to 1 AU.

Mentions: RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCU*AACGUCAUG)dT (32) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 32 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 32 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed as described in the caption of Figure 4.


Permanent or reversible conjugation of 2'-O- or 5'-O-aminooxymethylated nucleosides with functional groups as a convenient and efficient approach to the modification of RNA and DNA sequences.

Cieslak J, Grajkowski A, Ausín C, Gapeev A, Beaucage SL - Nucleic Acids Res. (2011)

RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCUAACGUCAUG)dT (31) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 31 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 31 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed using UV detection (254 nm) and a 5 μm Supelcosil LC-18S column (25 cm × 4.6 mm) according to the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min and was then held, isocratically, for 20 min. Peak heights are normalized to the highest peak, which is set to 1 AU.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3300013&req=5

gkr896-F4: RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCUAACGUCAUG)dT (31) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 31 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 31 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed using UV detection (254 nm) and a 5 μm Supelcosil LC-18S column (25 cm × 4.6 mm) according to the following conditions: starting from 0.1 M triethylammonium acetate pH 7.0, a linear gradient of 1% MeCN/min was pumped at a flow rate of 1 ml/min for 40 min and was then held, isocratically, for 20 min. Peak heights are normalized to the highest peak, which is set to 1 AU.
Mentions: RP-HPLC analysis of purified and desalted 5′-r(U*AUCCGUAGCU*AACGUCAUG)dT (32) [U* and dT represent 2′-O-(pyren-1-ylmethanimine-N-oxymethyl)uridine and 2′-deoxythymidine residues, respectively] and its conversion to 5′-r(UAUCCGUAGCUAACGUCAUG)dT (33). (A) Chromatogram of 32 that was prepared from the 2′-O-pyrenylated ribonucleoside phosphoramidite 8a and commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, deprotected, RP-HPLC purified and desalted as delineated in the ‘Materials and Methods’ section. (B) Chromatogram of 33 that was prepared from commercial 2′-O-(tert-butyldimethylsilyl) APac, GPac, CAc and U phosphoramidite monomers, and processed as described in (A). (C) Chromatogram of RP-HPLC purified and desalted 32 that was treated with 0.5 M TBAF in DMSO for 2 h at 55°C and then desalted. RP-HPLC analysis was performed as described in the caption of Figure 4.

Bottom Line: The reaction of these novel ribonucleosides with 1-pyrenecarboxaldehyde results in the efficient formation of stable and yet reversible ribonucleoside 2'-conjugates in yields of 69-82%.Although the versatility and uniqueness of 2'-O-aminooxymethyl ribonucleosides in the preparation of modified RNA sequences is demonstrated by the single or double incorporation of a reversible pyrenylated uridine 2'-conjugate into an RNA sequence, the conjugation of 2'-O-aminooxymethyl ribonucleosides with aldehydes, including those generated from their acetals, provides reversible 2'-O-protected ribonucleosides for potential applications in the solid-phase synthesis of native RNA sequences.The synthesis of a chimeric polyuridylic acid is presented as an exemplary model.

View Article: PubMed Central - PubMed

Affiliation: Division of Therapeutic Proteins, Center for Drug Evaluation and Research, Food and Drug Administration, 8800 Rockville Pike, Bethesda, MD 20892, USA.

ABSTRACT
2'-O-Aminooxymethyl ribonucleosides are prepared from their 3',5'-disilylated 2'-O-phthalimidooxymethyl derivatives by treatment with NH(4)F in MeOH. The reaction of these novel ribonucleosides with 1-pyrenecarboxaldehyde results in the efficient formation of stable and yet reversible ribonucleoside 2'-conjugates in yields of 69-82%. Indeed, exposure of these conjugates to 0.5 M tetra-n-butylammonium fluoride (TBAF) in THF results in the cleavage of their iminoether functions to give the native ribonucleosides along with the innocuous nitrile side product. Conversely, the reaction of 5-cholesten-3-one or dansyl chloride with 2'-O-aminooxymethyl uridine provides permanent uridine 2'-conjugates, which are left essentially intact upon treatment with TBAF. Alternatively, 5'-O-aminooxymethyl thymidine is prepared by hydrazinolysis of its 3'-O-levulinyl-5'-O-phthalimidooxymethyl precursor. Pyrenylation of 5'-O-aminooxymethyl thymidine and the sensitivity of the 5'-conjugate to TBAF further exemplify the usefulness of this nucleoside for modifying DNA sequences either permanently or reversibly. Although the versatility and uniqueness of 2'-O-aminooxymethyl ribonucleosides in the preparation of modified RNA sequences is demonstrated by the single or double incorporation of a reversible pyrenylated uridine 2'-conjugate into an RNA sequence, the conjugation of 2'-O-aminooxymethyl ribonucleosides with aldehydes, including those generated from their acetals, provides reversible 2'-O-protected ribonucleosides for potential applications in the solid-phase synthesis of native RNA sequences. The synthesis of a chimeric polyuridylic acid is presented as an exemplary model.

Show MeSH
Related in: MedlinePlus