Limits...
The food additive vanillic acid controls transgene expression in mammalian cells and mice.

Gitzinger M, Kemmer C, Fluri DA, El-Baba MD, Weber W, Fussenegger M - Nucleic Acids Res. (2011)

Bottom Line: Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells.When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism.As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

View Article: PubMed Central - PubMed

Affiliation: Department of Biosystems Science and Engineering (D-BSSE), ETH Zurich, Mattenstrasse 26, CH-4058 Basel, Switzerland.

ABSTRACT
Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells. When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism. Capitalizing on control components that enable Caulobacter crescentus to metabolize vanillic acid originating from lignin degradation that occurs in its oligotrophic freshwater habitat, we have designed synthetic devices that specifically adjust transgene expression in mammalian cells when exposed to vanillic acid. Even in mice transgene expression was robust, precise and tunable in response to vanillic acid. As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

Show MeSH

Related in: MedlinePlus

Design and validation of the VACON and VACOFF systems. (A and B) Diagram and functionality of the VACON system. (A) VanR was fused to the KRAB transrepressor domain, a human Krueppel-associated box protein, resulting in VanA4 (VanR-KRAB), which was expressed by the constitutive human cytomegalovirus immediate early promoter (PhCMV) (pCK189). The vanillic acid-inducible promoter PVanON8 harbors eight VanO operator sites immediately 3′ of a constitutive Simian virus 40 promoter (PSV40) that was set to drive the human placental secreted alkaline phosphatase (SEAP) (pCK191). OFF status: VanA4 is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to PVanON8 and represses SEAP expression. ON status: in the presence of vanillic acid (+VAC), VanA4 is released from PVanON8 which fully induces SEAP expression. (B) CHO-K1 cells were transiently transfected with pCK189 (PSV40-VanA4-pA) and pCK191 (PVanON8-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM). (C and D) Diagram and functionality of the VACOFF system. (C) VanR was fused to the VP16 transactivation domain of the Herpes simplex virus, resulting in VanA1 (VanR-VP16), which was expressed by the constitutive Simian virus 40 promoter (PSV40) (pMG250). The vanillic acid-responsive promoter P1VanO2 contains two VanO operator sites (ATTGGATCCAATAGCGCTATTGGATCCAAT; VanR binding sites in italics) immediately 5′ of a minimal human cytomegalovirus immediate-early promoter (PhCMVmin), which was set to drive the human placental secreted alkaline phosphatase (SEAP) (pMG252). ON status: VanA1 is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to P1VanO2 and activates SEAP expression. OFF status: in the presence of vanillic acid (+VAC), VanA1 is released from P1VanO2 which shuts down SEAP expression. (D) CHO-K1 cells were transiently transfected with pMG250 (PSV40-VanA1-pA) and pMG252 (P1VanO2-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM).
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3300003&req=5

gkr1251-F1: Design and validation of the VACON and VACOFF systems. (A and B) Diagram and functionality of the VACON system. (A) VanR was fused to the KRAB transrepressor domain, a human Krueppel-associated box protein, resulting in VanA4 (VanR-KRAB), which was expressed by the constitutive human cytomegalovirus immediate early promoter (PhCMV) (pCK189). The vanillic acid-inducible promoter PVanON8 harbors eight VanO operator sites immediately 3′ of a constitutive Simian virus 40 promoter (PSV40) that was set to drive the human placental secreted alkaline phosphatase (SEAP) (pCK191). OFF status: VanA4 is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to PVanON8 and represses SEAP expression. ON status: in the presence of vanillic acid (+VAC), VanA4 is released from PVanON8 which fully induces SEAP expression. (B) CHO-K1 cells were transiently transfected with pCK189 (PSV40-VanA4-pA) and pCK191 (PVanON8-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM). (C and D) Diagram and functionality of the VACOFF system. (C) VanR was fused to the VP16 transactivation domain of the Herpes simplex virus, resulting in VanA1 (VanR-VP16), which was expressed by the constitutive Simian virus 40 promoter (PSV40) (pMG250). The vanillic acid-responsive promoter P1VanO2 contains two VanO operator sites (ATTGGATCCAATAGCGCTATTGGATCCAAT; VanR binding sites in italics) immediately 5′ of a minimal human cytomegalovirus immediate-early promoter (PhCMVmin), which was set to drive the human placental secreted alkaline phosphatase (SEAP) (pMG252). ON status: VanA1 is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to P1VanO2 and activates SEAP expression. OFF status: in the presence of vanillic acid (+VAC), VanA1 is released from P1VanO2 which shuts down SEAP expression. (D) CHO-K1 cells were transiently transfected with pMG250 (PSV40-VanA1-pA) and pMG252 (P1VanO2-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM).

Mentions: The VACON system was assembled by fusing VanR C-terminally to the human Krueppel-associated box [KRAB; (52)] domain to generate a mammalian transsilencer (VanA4) that binds and represses a chimeric promoter (PVanON8) consisting of a constitutive human cytomegalovirus immediate early promoter (PhCMV) containing an octameric VanO operator module (VanO8) immediately downstream. Vanillic acid triggers the release of VanA4, which derepresses PVanON8 and results in PhCMV-driven transgene expression (Figure 1A). When co-transfecting pCK189 (PhCMV-VanA4-pA) and pCK191 (PVanON8-SEAP-pA) into CHO-K1 expression of SEAP was insignificant (1.70 ± 0.23 U/L). However, when adding increasing concentrations of vanillic acid (0–250 μM) SEAP expression was dose-dependently induced up to a level of 25.3 ± 2.08 U/l (Figure 1B).Figure 1.


The food additive vanillic acid controls transgene expression in mammalian cells and mice.

Gitzinger M, Kemmer C, Fluri DA, El-Baba MD, Weber W, Fussenegger M - Nucleic Acids Res. (2011)

Design and validation of the VACON and VACOFF systems. (A and B) Diagram and functionality of the VACON system. (A) VanR was fused to the KRAB transrepressor domain, a human Krueppel-associated box protein, resulting in VanA4 (VanR-KRAB), which was expressed by the constitutive human cytomegalovirus immediate early promoter (PhCMV) (pCK189). The vanillic acid-inducible promoter PVanON8 harbors eight VanO operator sites immediately 3′ of a constitutive Simian virus 40 promoter (PSV40) that was set to drive the human placental secreted alkaline phosphatase (SEAP) (pCK191). OFF status: VanA4 is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to PVanON8 and represses SEAP expression. ON status: in the presence of vanillic acid (+VAC), VanA4 is released from PVanON8 which fully induces SEAP expression. (B) CHO-K1 cells were transiently transfected with pCK189 (PSV40-VanA4-pA) and pCK191 (PVanON8-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM). (C and D) Diagram and functionality of the VACOFF system. (C) VanR was fused to the VP16 transactivation domain of the Herpes simplex virus, resulting in VanA1 (VanR-VP16), which was expressed by the constitutive Simian virus 40 promoter (PSV40) (pMG250). The vanillic acid-responsive promoter P1VanO2 contains two VanO operator sites (ATTGGATCCAATAGCGCTATTGGATCCAAT; VanR binding sites in italics) immediately 5′ of a minimal human cytomegalovirus immediate-early promoter (PhCMVmin), which was set to drive the human placental secreted alkaline phosphatase (SEAP) (pMG252). ON status: VanA1 is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to P1VanO2 and activates SEAP expression. OFF status: in the presence of vanillic acid (+VAC), VanA1 is released from P1VanO2 which shuts down SEAP expression. (D) CHO-K1 cells were transiently transfected with pMG250 (PSV40-VanA1-pA) and pMG252 (P1VanO2-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM).
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3300003&req=5

gkr1251-F1: Design and validation of the VACON and VACOFF systems. (A and B) Diagram and functionality of the VACON system. (A) VanR was fused to the KRAB transrepressor domain, a human Krueppel-associated box protein, resulting in VanA4 (VanR-KRAB), which was expressed by the constitutive human cytomegalovirus immediate early promoter (PhCMV) (pCK189). The vanillic acid-inducible promoter PVanON8 harbors eight VanO operator sites immediately 3′ of a constitutive Simian virus 40 promoter (PSV40) that was set to drive the human placental secreted alkaline phosphatase (SEAP) (pCK191). OFF status: VanA4 is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to PVanON8 and represses SEAP expression. ON status: in the presence of vanillic acid (+VAC), VanA4 is released from PVanON8 which fully induces SEAP expression. (B) CHO-K1 cells were transiently transfected with pCK189 (PSV40-VanA4-pA) and pCK191 (PVanON8-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM). (C and D) Diagram and functionality of the VACOFF system. (C) VanR was fused to the VP16 transactivation domain of the Herpes simplex virus, resulting in VanA1 (VanR-VP16), which was expressed by the constitutive Simian virus 40 promoter (PSV40) (pMG250). The vanillic acid-responsive promoter P1VanO2 contains two VanO operator sites (ATTGGATCCAATAGCGCTATTGGATCCAAT; VanR binding sites in italics) immediately 5′ of a minimal human cytomegalovirus immediate-early promoter (PhCMVmin), which was set to drive the human placental secreted alkaline phosphatase (SEAP) (pMG252). ON status: VanA1 is constitutively expressed and, in the absence of vanillic acid (–VAC), binds to P1VanO2 and activates SEAP expression. OFF status: in the presence of vanillic acid (+VAC), VanA1 is released from P1VanO2 which shuts down SEAP expression. (D) CHO-K1 cells were transiently transfected with pMG250 (PSV40-VanA1-pA) and pMG252 (P1VanO2-SEAP-pA) and SEAP-expression profiles were assessed 48 h after cultivation of the cells in medium containing different concentrations of vanillic acid (0–250 μM).
Mentions: The VACON system was assembled by fusing VanR C-terminally to the human Krueppel-associated box [KRAB; (52)] domain to generate a mammalian transsilencer (VanA4) that binds and represses a chimeric promoter (PVanON8) consisting of a constitutive human cytomegalovirus immediate early promoter (PhCMV) containing an octameric VanO operator module (VanO8) immediately downstream. Vanillic acid triggers the release of VanA4, which derepresses PVanON8 and results in PhCMV-driven transgene expression (Figure 1A). When co-transfecting pCK189 (PhCMV-VanA4-pA) and pCK191 (PVanON8-SEAP-pA) into CHO-K1 expression of SEAP was insignificant (1.70 ± 0.23 U/L). However, when adding increasing concentrations of vanillic acid (0–250 μM) SEAP expression was dose-dependently induced up to a level of 25.3 ± 2.08 U/l (Figure 1B).Figure 1.

Bottom Line: Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells.When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism.As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

View Article: PubMed Central - PubMed

Affiliation: Department of Biosystems Science and Engineering (D-BSSE), ETH Zurich, Mattenstrasse 26, CH-4058 Basel, Switzerland.

ABSTRACT
Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells. When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism. Capitalizing on control components that enable Caulobacter crescentus to metabolize vanillic acid originating from lignin degradation that occurs in its oligotrophic freshwater habitat, we have designed synthetic devices that specifically adjust transgene expression in mammalian cells when exposed to vanillic acid. Even in mice transgene expression was robust, precise and tunable in response to vanillic acid. As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

Show MeSH
Related in: MedlinePlus