Limits...
Bacterial ribosome requires multiple L12 dimers for efficient initiation and elongation of protein synthesis involving IF2 and EF-G.

Mandava CS, Peisker K, Ederth J, Kumar R, Ge X, Szaflarski W, Sanyal S - Nucleic Acids Res. (2011)

Bottom Line: Thus JE105 harbors ribosomes with only a single L12 dimer.When tested in a cell-free reconstituted transcription-translation assay the synthesis of a full-length protein, firefly luciferase, was notably slower with JE105 70S ribosomes and 50S subunits.Further, in vitro analysis by fast kinetics revealed that single L12 dimer ribosomes from JE105 are defective in two major steps of translation, namely initiation and elongation involving translational GTPases IF2 and EF-G.

View Article: PubMed Central - PubMed

Affiliation: Department of Cell and Molecular Biology, Uppsala University, BMC, Box-596, SE-751 24 Uppsala, Sweden.

ABSTRACT
The ribosomal stalk in bacteria is composed of four or six copies of L12 proteins arranged in dimers that bind to the adjacent sites on protein L10, spanning 10 amino acids each from the L10 C-terminus. To study why multiple L12 dimers are required on the ribosome, we created a chromosomally engineered Escherichia coli strain, JE105, in which the peripheral L12 dimer binding site was deleted. Thus JE105 harbors ribosomes with only a single L12 dimer. Compared to MG1655, the parental strain with two L12 dimers, JE105 showed significant growth defect suggesting suboptimal function of the ribosomes with one L12 dimer. When tested in a cell-free reconstituted transcription-translation assay the synthesis of a full-length protein, firefly luciferase, was notably slower with JE105 70S ribosomes and 50S subunits. Further, in vitro analysis by fast kinetics revealed that single L12 dimer ribosomes from JE105 are defective in two major steps of translation, namely initiation and elongation involving translational GTPases IF2 and EF-G. Varying number of L12 dimers on the ribosome can be a mechanism in bacteria for modulating the rate of translation in response to growth condition.

Show MeSH

Related in: MedlinePlus

Construction and characterization of JE105 strain. (a) A scheme showing the steps for construction of JE105, where last 33 nucleotides of rplJ gene in the chromosome of E. coli MG1655 was replaced with an Amp cassette by means of lambda Red recombineering (left). While MG1655 ribosome has two L12 dimers bound to L10, JE105 ribosome lacked the peripheral L12 dimer due to deletion of the binding site (II) (right). (b) Agarose gel electrophoresis showing bands from colony PCR with MG1655 (lanes 3 and 5) and JE105 (lanes 2 and 4) using primers In Amp and Down L12 (lanes 2 and 3) and Up L10 and Down L12 (lanes 4 and 5). (c) The growth curves for MG1655 (black) and JE105 (red) in LB at 37°C. The generation times are listed in the box.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3299993&req=5

gkr1031-F1: Construction and characterization of JE105 strain. (a) A scheme showing the steps for construction of JE105, where last 33 nucleotides of rplJ gene in the chromosome of E. coli MG1655 was replaced with an Amp cassette by means of lambda Red recombineering (left). While MG1655 ribosome has two L12 dimers bound to L10, JE105 ribosome lacked the peripheral L12 dimer due to deletion of the binding site (II) (right). (b) Agarose gel electrophoresis showing bands from colony PCR with MG1655 (lanes 3 and 5) and JE105 (lanes 2 and 4) using primers In Amp and Down L12 (lanes 2 and 3) and Up L10 and Down L12 (lanes 4 and 5). (c) The growth curves for MG1655 (black) and JE105 (red) in LB at 37°C. The generation times are listed in the box.

Mentions: The last 33 nucleotides of the rplJ gene of E. coli MG1655 were replaced at its chromosomal locus with an ampicillin-resistance cassette (Amp) by means of lambda red recombineering (28,29) (Figure 1a). The Amp cassette was produced by PCR amplification from the plasmid PBR322 with primers 5′ACCATGAAAGAAGCTTCGGCTGGCAAACTGGTTCGTACTCTGtaatcgcagttatctttttaacgcattcgcttacgtataaactta3′ and 5′TAAGTTTATACGTAAGCGAATGCGTTAAAAAGATAACTGCGAttaagcagcttctttcgcatcacgaactgctgcagcagcttcttt3′ having 45 nucleotide homologies to the flanking sequences of the target region (shown in uppercase letters). Recombinants were selected on LB agar-amp (100 µg ml−1) plates and were further screened by PCR using forward primers upL10 – 5′tatccaggcctccgtcgaaga3′, and in Amp – 5 ′tgctgataaatctggagccg3′ in combination with the reverse primer downL12 – 5′tgtgaaacgctactggcgcct3′ (Figure 1b). One of the successful recombinants, named JE105 [MG1655 (rplJΔ30)-Amp], was used for this study. The replacement was confirmed by DNA sequencing.Figure 1.


Bacterial ribosome requires multiple L12 dimers for efficient initiation and elongation of protein synthesis involving IF2 and EF-G.

Mandava CS, Peisker K, Ederth J, Kumar R, Ge X, Szaflarski W, Sanyal S - Nucleic Acids Res. (2011)

Construction and characterization of JE105 strain. (a) A scheme showing the steps for construction of JE105, where last 33 nucleotides of rplJ gene in the chromosome of E. coli MG1655 was replaced with an Amp cassette by means of lambda Red recombineering (left). While MG1655 ribosome has two L12 dimers bound to L10, JE105 ribosome lacked the peripheral L12 dimer due to deletion of the binding site (II) (right). (b) Agarose gel electrophoresis showing bands from colony PCR with MG1655 (lanes 3 and 5) and JE105 (lanes 2 and 4) using primers In Amp and Down L12 (lanes 2 and 3) and Up L10 and Down L12 (lanes 4 and 5). (c) The growth curves for MG1655 (black) and JE105 (red) in LB at 37°C. The generation times are listed in the box.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3299993&req=5

gkr1031-F1: Construction and characterization of JE105 strain. (a) A scheme showing the steps for construction of JE105, where last 33 nucleotides of rplJ gene in the chromosome of E. coli MG1655 was replaced with an Amp cassette by means of lambda Red recombineering (left). While MG1655 ribosome has two L12 dimers bound to L10, JE105 ribosome lacked the peripheral L12 dimer due to deletion of the binding site (II) (right). (b) Agarose gel electrophoresis showing bands from colony PCR with MG1655 (lanes 3 and 5) and JE105 (lanes 2 and 4) using primers In Amp and Down L12 (lanes 2 and 3) and Up L10 and Down L12 (lanes 4 and 5). (c) The growth curves for MG1655 (black) and JE105 (red) in LB at 37°C. The generation times are listed in the box.
Mentions: The last 33 nucleotides of the rplJ gene of E. coli MG1655 were replaced at its chromosomal locus with an ampicillin-resistance cassette (Amp) by means of lambda red recombineering (28,29) (Figure 1a). The Amp cassette was produced by PCR amplification from the plasmid PBR322 with primers 5′ACCATGAAAGAAGCTTCGGCTGGCAAACTGGTTCGTACTCTGtaatcgcagttatctttttaacgcattcgcttacgtataaactta3′ and 5′TAAGTTTATACGTAAGCGAATGCGTTAAAAAGATAACTGCGAttaagcagcttctttcgcatcacgaactgctgcagcagcttcttt3′ having 45 nucleotide homologies to the flanking sequences of the target region (shown in uppercase letters). Recombinants were selected on LB agar-amp (100 µg ml−1) plates and were further screened by PCR using forward primers upL10 – 5′tatccaggcctccgtcgaaga3′, and in Amp – 5 ′tgctgataaatctggagccg3′ in combination with the reverse primer downL12 – 5′tgtgaaacgctactggcgcct3′ (Figure 1b). One of the successful recombinants, named JE105 [MG1655 (rplJΔ30)-Amp], was used for this study. The replacement was confirmed by DNA sequencing.Figure 1.

Bottom Line: Thus JE105 harbors ribosomes with only a single L12 dimer.When tested in a cell-free reconstituted transcription-translation assay the synthesis of a full-length protein, firefly luciferase, was notably slower with JE105 70S ribosomes and 50S subunits.Further, in vitro analysis by fast kinetics revealed that single L12 dimer ribosomes from JE105 are defective in two major steps of translation, namely initiation and elongation involving translational GTPases IF2 and EF-G.

View Article: PubMed Central - PubMed

Affiliation: Department of Cell and Molecular Biology, Uppsala University, BMC, Box-596, SE-751 24 Uppsala, Sweden.

ABSTRACT
The ribosomal stalk in bacteria is composed of four or six copies of L12 proteins arranged in dimers that bind to the adjacent sites on protein L10, spanning 10 amino acids each from the L10 C-terminus. To study why multiple L12 dimers are required on the ribosome, we created a chromosomally engineered Escherichia coli strain, JE105, in which the peripheral L12 dimer binding site was deleted. Thus JE105 harbors ribosomes with only a single L12 dimer. Compared to MG1655, the parental strain with two L12 dimers, JE105 showed significant growth defect suggesting suboptimal function of the ribosomes with one L12 dimer. When tested in a cell-free reconstituted transcription-translation assay the synthesis of a full-length protein, firefly luciferase, was notably slower with JE105 70S ribosomes and 50S subunits. Further, in vitro analysis by fast kinetics revealed that single L12 dimer ribosomes from JE105 are defective in two major steps of translation, namely initiation and elongation involving translational GTPases IF2 and EF-G. Varying number of L12 dimers on the ribosome can be a mechanism in bacteria for modulating the rate of translation in response to growth condition.

Show MeSH
Related in: MedlinePlus