Limits...
Enhanced in vitro refolding of fibroblast growth factor 15 with the assistance of SUMO fusion partner.

Kong B, Guo GL - PLoS ONE (2011)

Bottom Line: However, when expressed in Escherichia coli (E. coli), the recombinant Fgf15 protein was insoluble and found only in inclusion bodies.Even though the SUMO has been shown to strongly improve protein solubility and expression levels, our studies suggest that the SUMO does not improve Fgf15 protein solubility.With or without the SUMO tag, the refolded Fgf15 protein was biologically active, as revealed by its ability to reduce hepatic Cyp7a1 mRNA levels in mice.

View Article: PubMed Central - PubMed

Affiliation: Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, Kansas, United States of America.

ABSTRACT
Fibroblast growth factor 15 (Fgf15) is the mouse orthologue of human FGF19. Fgf15 is highly expressed in the ileum and functions as an endocrine signal to regulate liver function, including bile acid synthesis, hepatocyte proliferation and insulin sensitivity. In order to fully understand the function of Fgf15, methods are needed to produce pure Fgf15 protein in the prokaryotic system. However, when expressed in Escherichia coli (E. coli), the recombinant Fgf15 protein was insoluble and found only in inclusion bodies. In the current study, we report a method to produce recombinant Fgf15 protein in E. coli through the use of small ubiquitin-related modifier (SUMO) fusion tag. Even though the SUMO has been shown to strongly improve protein solubility and expression levels, our studies suggest that the SUMO does not improve Fgf15 protein solubility. Instead, proper refolding of Fgf15 protein was achieved when Fgf15 was expressed as a partner protein of the fusion tag SUMO, followed by in vitro dialysis refolding. After refolding, the N-terminal SUMO tag was cleaved from the recombinant Fgf15 fusion protein by ScUlp1 (Ubiquitin-Like Protein-Specific Protease 1 from S. cerevisiae). With or without the SUMO tag, the refolded Fgf15 protein was biologically active, as revealed by its ability to reduce hepatic Cyp7a1 mRNA levels in mice. In addition, recombinant Fgf15 protein suppressed Cyp7a1 mRNA levels in a dose-dependent manner. In summary, we have developed a successful method to express functional Fgf15 protein in prokaryotic cells.

Show MeSH

Related in: MedlinePlus

Schematic of expression vectors.pET28a(+) vector backbone has been used to construct the expression vectors. His6-tag has been attached to the N-terminus of the target protein, and the stop codon, TGA, has been added in front of the XhoI restriction enzyme site. Two glycine amino acids have been introduced to the C-terminus of SUMO protein, which is required for the ScUlp1 cleavage. SP, signal peptide.
© Copyright Policy
Related In: Results  -  Collection


getmorefigures.php?uid=PMC3105028&req=5

pone-0020307-g001: Schematic of expression vectors.pET28a(+) vector backbone has been used to construct the expression vectors. His6-tag has been attached to the N-terminus of the target protein, and the stop codon, TGA, has been added in front of the XhoI restriction enzyme site. Two glycine amino acids have been introduced to the C-terminus of SUMO protein, which is required for the ScUlp1 cleavage. SP, signal peptide.

Mentions: Yeast (S. cerevisiae) SUMO and the C-terminal protease domain of Ulp1 (ScUlp1) were PCR amplified from yeast genomic DNA using Phusion High-Fidelity DNA Polymerase (NEB) by primers: ScUlp1_F: CGCGGGATCCAAACTTGTTCCTGAATTAAATG, ScUlp1_R: GACTCTCGAGTTATTTTAAAGCGTCGGTTAAAATC, SUMO_F: CGCGGATCCATGTCGGACTCAGAAGTCAATC, SUMO_R: CGCAAGCTTACCACCAATCTGTTCTCTGTG. The Fgf15 gene was amplified from mouse intestinal total cDNA using the primers Fgf15_F: CGCAAGCTTATGGCGAGAAAGTGGAACGG and Fgf15_R: GACTCTCGAGTCATTTCTGGAAGCTGGGAC. Truncated Fgf15 (tFgf15) gene without a coding fragment for the signal peptide was amplified using primers tFgf15_F: CGCAAGCTTCGTCCCCTGGCTCAGCAATC, and tFgf15_R: GACTCTCGAGTCATTTCTGGAAGCTGGGAC. Sequences underlined were the restriction enzyme sites used for inserting amplified fragments into the bacterial expression vector, pET28a(+). Two additional glycines [19], [20], [21] required for ScUlp1 protease to cleave the SUMO tag were inserted between the SUMO fusion tag and Fgf15 protein with an N-terminal His6-tag. All plasmids used for protein expression are shown in Figure 1.


Enhanced in vitro refolding of fibroblast growth factor 15 with the assistance of SUMO fusion partner.

Kong B, Guo GL - PLoS ONE (2011)

Schematic of expression vectors.pET28a(+) vector backbone has been used to construct the expression vectors. His6-tag has been attached to the N-terminus of the target protein, and the stop codon, TGA, has been added in front of the XhoI restriction enzyme site. Two glycine amino acids have been introduced to the C-terminus of SUMO protein, which is required for the ScUlp1 cleavage. SP, signal peptide.
© Copyright Policy
Related In: Results  -  Collection

Show All Figures
getmorefigures.php?uid=PMC3105028&req=5

pone-0020307-g001: Schematic of expression vectors.pET28a(+) vector backbone has been used to construct the expression vectors. His6-tag has been attached to the N-terminus of the target protein, and the stop codon, TGA, has been added in front of the XhoI restriction enzyme site. Two glycine amino acids have been introduced to the C-terminus of SUMO protein, which is required for the ScUlp1 cleavage. SP, signal peptide.
Mentions: Yeast (S. cerevisiae) SUMO and the C-terminal protease domain of Ulp1 (ScUlp1) were PCR amplified from yeast genomic DNA using Phusion High-Fidelity DNA Polymerase (NEB) by primers: ScUlp1_F: CGCGGGATCCAAACTTGTTCCTGAATTAAATG, ScUlp1_R: GACTCTCGAGTTATTTTAAAGCGTCGGTTAAAATC, SUMO_F: CGCGGATCCATGTCGGACTCAGAAGTCAATC, SUMO_R: CGCAAGCTTACCACCAATCTGTTCTCTGTG. The Fgf15 gene was amplified from mouse intestinal total cDNA using the primers Fgf15_F: CGCAAGCTTATGGCGAGAAAGTGGAACGG and Fgf15_R: GACTCTCGAGTCATTTCTGGAAGCTGGGAC. Truncated Fgf15 (tFgf15) gene without a coding fragment for the signal peptide was amplified using primers tFgf15_F: CGCAAGCTTCGTCCCCTGGCTCAGCAATC, and tFgf15_R: GACTCTCGAGTCATTTCTGGAAGCTGGGAC. Sequences underlined were the restriction enzyme sites used for inserting amplified fragments into the bacterial expression vector, pET28a(+). Two additional glycines [19], [20], [21] required for ScUlp1 protease to cleave the SUMO tag were inserted between the SUMO fusion tag and Fgf15 protein with an N-terminal His6-tag. All plasmids used for protein expression are shown in Figure 1.

Bottom Line: However, when expressed in Escherichia coli (E. coli), the recombinant Fgf15 protein was insoluble and found only in inclusion bodies.Even though the SUMO has been shown to strongly improve protein solubility and expression levels, our studies suggest that the SUMO does not improve Fgf15 protein solubility.With or without the SUMO tag, the refolded Fgf15 protein was biologically active, as revealed by its ability to reduce hepatic Cyp7a1 mRNA levels in mice.

View Article: PubMed Central - PubMed

Affiliation: Department of Pharmacology, Toxicology, and Therapeutics, University of Kansas Medical Center, Kansas City, Kansas, United States of America.

ABSTRACT
Fibroblast growth factor 15 (Fgf15) is the mouse orthologue of human FGF19. Fgf15 is highly expressed in the ileum and functions as an endocrine signal to regulate liver function, including bile acid synthesis, hepatocyte proliferation and insulin sensitivity. In order to fully understand the function of Fgf15, methods are needed to produce pure Fgf15 protein in the prokaryotic system. However, when expressed in Escherichia coli (E. coli), the recombinant Fgf15 protein was insoluble and found only in inclusion bodies. In the current study, we report a method to produce recombinant Fgf15 protein in E. coli through the use of small ubiquitin-related modifier (SUMO) fusion tag. Even though the SUMO has been shown to strongly improve protein solubility and expression levels, our studies suggest that the SUMO does not improve Fgf15 protein solubility. Instead, proper refolding of Fgf15 protein was achieved when Fgf15 was expressed as a partner protein of the fusion tag SUMO, followed by in vitro dialysis refolding. After refolding, the N-terminal SUMO tag was cleaved from the recombinant Fgf15 fusion protein by ScUlp1 (Ubiquitin-Like Protein-Specific Protease 1 from S. cerevisiae). With or without the SUMO tag, the refolded Fgf15 protein was biologically active, as revealed by its ability to reduce hepatic Cyp7a1 mRNA levels in mice. In addition, recombinant Fgf15 protein suppressed Cyp7a1 mRNA levels in a dose-dependent manner. In summary, we have developed a successful method to express functional Fgf15 protein in prokaryotic cells.

Show MeSH
Related in: MedlinePlus