Limits...
The mitochondrial DNA 4,977-bp deletion and its implication in copy number alteration in colorectal cancer.

Chen T, He J, Shen L, Fang H, Nie H, Jin T, Wei X, Xin Y, Jiang Y, Li H, Chen G, Lu J, Bai Y - BMC Med. Genet. (2011)

Bottom Line: A 4,977 bp deletion in the major arch of the mitochondrial genome is one of the most common mutations associated with a variety of human diseases and aging. we conducted a comprehensive study on clinical features and mtDNA of 104 colorectal cancer patients in the Wenzhou area of China.In particular, using a quantitative real time PCR method, we analyzed the 4,977 bp deletion and mtDNA content in tumor tissues and paired non-tumor areas from these patients. we found that the 4,977 bp deletion was more likely to be present in patients of younger age (≤65 years, p = 0.027).Moreover, mtDNA copy number in tumor tissues of patients with this deletion increased, both compared with that in adjacent non-tumor tissues and with in tumors of patients without the deletion.

View Article: PubMed Central - HTML - PubMed

Affiliation: Zhejiang Provincial Key Laboratory of Medical Genetics, School of Laboratory Medicine of Wenzhou Medical College, Zhejiang 325035, PRChina.

ABSTRACT

Background: qualitative and quantitative changes in human mitochondrial DNA (mtDNA) have been implicated in various cancer types. A 4,977 bp deletion in the major arch of the mitochondrial genome is one of the most common mutations associated with a variety of human diseases and aging.

Methods: we conducted a comprehensive study on clinical features and mtDNA of 104 colorectal cancer patients in the Wenzhou area of China. In particular, using a quantitative real time PCR method, we analyzed the 4,977 bp deletion and mtDNA content in tumor tissues and paired non-tumor areas from these patients.

Results: we found that the 4,977 bp deletion was more likely to be present in patients of younger age (≤65 years, p = 0.027). In patients with the 4,977 bp deletion, the deletion level decreased as the cancer stage advanced (p = 0.031). Moreover, mtDNA copy number in tumor tissues of patients with this deletion increased, both compared with that in adjacent non-tumor tissues and with in tumors of patients without the deletion. Such mtDNA content increase correlated with the levels of the 4,977 bp deletion and with cancer stage (p < 0.001).

Conclusions: our study indicates that the mtDNA 4,977 bp deletion may play a role in the early stage of colorectal cancer, and it is also implicated in alteration of mtDNA content in cancer cells.

Show MeSH

Related in: MedlinePlus

Detection of the mtDNA 4,977-bp deletion. (A) Human mitochondrial genome with or without the 4,977-bp deletion; the positions of primers used in nested PCR for detecting this deletion were 1F (8192-8212), 1R (13663-13643), 2F (8261-8281) and 2R (13595-13575). The fragment was too large for wildtype mtDNA (>5 kb) to be amplified with the PCR conditions used for detection. (B) Confirmation of the 4,977 bp deletion. Representative sequencing profile of the PCR products from the patients carrying the deletion.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3025938&req=5

Figure 1: Detection of the mtDNA 4,977-bp deletion. (A) Human mitochondrial genome with or without the 4,977-bp deletion; the positions of primers used in nested PCR for detecting this deletion were 1F (8192-8212), 1R (13663-13643), 2F (8261-8281) and 2R (13595-13575). The fragment was too large for wildtype mtDNA (>5 kb) to be amplified with the PCR conditions used for detection. (B) Confirmation of the 4,977 bp deletion. Representative sequencing profile of the PCR products from the patients carrying the deletion.

Mentions: Tumor and non-tumor tissues on the slides were extracted separately under a microscope. Genomic DNA was isolated as previously described [27]. To screen for the 4,977-bp deletion in mtDNA, nested PCR analysis was performed in order to detect low levels of deletion (Figure. 1). Two pairs of nested primers for detection of the 4,977-bp deletion were, 1F: AACCACAGTTTCATGCCCATC; 1R: TGTTAGTAAGGGTGGGGAAGC; 2F: ACCCTATTGCACCCCCTCTAC; and 2R: CTTGTCAGGGAGGTAGCGATG. The PCR condition was set as: pre-denaturation at 94°C for 5 min; then 30 cycles at 94°C for 10 s, 58 °C for 45 s and 72 °C for 50 s; and a final extension at 72 °C for 10 min. PCR products were then electrophoresed on a 2% agarose gel. By design (Figure. 1A), the presence of the 4,977-bp deletion was indicated by the appearance of a 358-bp band, which was verified by sequencing analysis (Figure. 1B). On the other hand, wild-type mtDNA as the template would not yield any PCR products under such conditions because of the large flanking region (>5-kb) (Figure. 1A). All PCR experiments included a negative control with no template DNA (double-distilled water) and a positive control with mtDNA harboring a 4,977-bp deletion which was isolated in the laboratory previously from a prostate cancer patient.


The mitochondrial DNA 4,977-bp deletion and its implication in copy number alteration in colorectal cancer.

Chen T, He J, Shen L, Fang H, Nie H, Jin T, Wei X, Xin Y, Jiang Y, Li H, Chen G, Lu J, Bai Y - BMC Med. Genet. (2011)

Detection of the mtDNA 4,977-bp deletion. (A) Human mitochondrial genome with or without the 4,977-bp deletion; the positions of primers used in nested PCR for detecting this deletion were 1F (8192-8212), 1R (13663-13643), 2F (8261-8281) and 2R (13595-13575). The fragment was too large for wildtype mtDNA (>5 kb) to be amplified with the PCR conditions used for detection. (B) Confirmation of the 4,977 bp deletion. Representative sequencing profile of the PCR products from the patients carrying the deletion.
© Copyright Policy - open-access
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3025938&req=5

Figure 1: Detection of the mtDNA 4,977-bp deletion. (A) Human mitochondrial genome with or without the 4,977-bp deletion; the positions of primers used in nested PCR for detecting this deletion were 1F (8192-8212), 1R (13663-13643), 2F (8261-8281) and 2R (13595-13575). The fragment was too large for wildtype mtDNA (>5 kb) to be amplified with the PCR conditions used for detection. (B) Confirmation of the 4,977 bp deletion. Representative sequencing profile of the PCR products from the patients carrying the deletion.
Mentions: Tumor and non-tumor tissues on the slides were extracted separately under a microscope. Genomic DNA was isolated as previously described [27]. To screen for the 4,977-bp deletion in mtDNA, nested PCR analysis was performed in order to detect low levels of deletion (Figure. 1). Two pairs of nested primers for detection of the 4,977-bp deletion were, 1F: AACCACAGTTTCATGCCCATC; 1R: TGTTAGTAAGGGTGGGGAAGC; 2F: ACCCTATTGCACCCCCTCTAC; and 2R: CTTGTCAGGGAGGTAGCGATG. The PCR condition was set as: pre-denaturation at 94°C for 5 min; then 30 cycles at 94°C for 10 s, 58 °C for 45 s and 72 °C for 50 s; and a final extension at 72 °C for 10 min. PCR products were then electrophoresed on a 2% agarose gel. By design (Figure. 1A), the presence of the 4,977-bp deletion was indicated by the appearance of a 358-bp band, which was verified by sequencing analysis (Figure. 1B). On the other hand, wild-type mtDNA as the template would not yield any PCR products under such conditions because of the large flanking region (>5-kb) (Figure. 1A). All PCR experiments included a negative control with no template DNA (double-distilled water) and a positive control with mtDNA harboring a 4,977-bp deletion which was isolated in the laboratory previously from a prostate cancer patient.

Bottom Line: A 4,977 bp deletion in the major arch of the mitochondrial genome is one of the most common mutations associated with a variety of human diseases and aging. we conducted a comprehensive study on clinical features and mtDNA of 104 colorectal cancer patients in the Wenzhou area of China.In particular, using a quantitative real time PCR method, we analyzed the 4,977 bp deletion and mtDNA content in tumor tissues and paired non-tumor areas from these patients. we found that the 4,977 bp deletion was more likely to be present in patients of younger age (≤65 years, p = 0.027).Moreover, mtDNA copy number in tumor tissues of patients with this deletion increased, both compared with that in adjacent non-tumor tissues and with in tumors of patients without the deletion.

View Article: PubMed Central - HTML - PubMed

Affiliation: Zhejiang Provincial Key Laboratory of Medical Genetics, School of Laboratory Medicine of Wenzhou Medical College, Zhejiang 325035, PRChina.

ABSTRACT

Background: qualitative and quantitative changes in human mitochondrial DNA (mtDNA) have been implicated in various cancer types. A 4,977 bp deletion in the major arch of the mitochondrial genome is one of the most common mutations associated with a variety of human diseases and aging.

Methods: we conducted a comprehensive study on clinical features and mtDNA of 104 colorectal cancer patients in the Wenzhou area of China. In particular, using a quantitative real time PCR method, we analyzed the 4,977 bp deletion and mtDNA content in tumor tissues and paired non-tumor areas from these patients.

Results: we found that the 4,977 bp deletion was more likely to be present in patients of younger age (≤65 years, p = 0.027). In patients with the 4,977 bp deletion, the deletion level decreased as the cancer stage advanced (p = 0.031). Moreover, mtDNA copy number in tumor tissues of patients with this deletion increased, both compared with that in adjacent non-tumor tissues and with in tumors of patients without the deletion. Such mtDNA content increase correlated with the levels of the 4,977 bp deletion and with cancer stage (p < 0.001).

Conclusions: our study indicates that the mtDNA 4,977 bp deletion may play a role in the early stage of colorectal cancer, and it is also implicated in alteration of mtDNA content in cancer cells.

Show MeSH
Related in: MedlinePlus