Limits...
Both polymorphic variable number of tandem repeats and autoimmune regulator modulate differential expression of insulin in human thymic epithelial cells.

Cai CQ, Zhang T, Breslin MB, Giraud M, Lan MS - Diabetes (2010)

Bottom Line: In a protein-DNA pull-down experiment, AIRE protein is capable of binding to VNTR class I and III probes.Further, the transcriptional activation of the INS-VNTR by AIRE requires the insulin basal promoter.The VNTR sequence loses its activation activity when linked to a heterologous promoter and/or enhancer.

View Article: PubMed Central - PubMed

Affiliation: The Research Institute for Children, Children’s Hospital, New Orleans, Louisiana, USA.

ABSTRACT

Objective: Polymorphic INS-VNTR plays an important role in regulating insulin transcript expression in the human thymus that leads to either insulin autoimmunity or tolerance. The molecular mechanisms underlying the INS-VNTR haplotype-dependent insulin expression are still unclear. In this study, we determined the mechanistic components underlying the differential insulin gene expression in human thymic epithelial cells, which should have profound effects on the insulin autoimmune tolerance induction.

Research design and methods: A repetitive DNA region designated as a variable number of tandem repeats (VNTR) is located upstream of the human insulin gene and correlates with the incidence of type 1 diabetes. We generated six class I and two class III VNTR constructs linked to the human insulin basal promoter or SV40 heterologous promoter/enhancer and demonstrated that AIRE protein modulates the insulin promoter activities differentially through binding to the VNTR region.

Results: Here we show that in the presence of the autoimmune regulator (AIRE), the class III VNTR haplotype is responsible for an average of three-fold higher insulin expression than class I VNTR in thymic epithelial cells. In a protein-DNA pull-down experiment, AIRE protein is capable of binding to VNTR class I and III probes. Further, the transcriptional activation of the INS-VNTR by AIRE requires the insulin basal promoter. The VNTR sequence loses its activation activity when linked to a heterologous promoter and/or enhancer.

Conclusions: These findings demonstrate a type 1 diabetes predisposition encoded by the INS-VNTR locus and a critical function played by AIRE, which constitute a dual control mechanisms regulating quantitative expression of insulin in human thymic epithelial cells.

Show MeSH

Related in: MedlinePlus

IDDM2-VNTR locus transduces a quantitative insulin expression signal in the presence of AIRE. A: Diagrammatic representation of the TH-INS-IGF2 interval on chromosome 11p15.5. INS or IDDM2 locus is bordered by TH (tyrosine hydroxylase) and IGF2 (insulin-like growth factor 2) loci. The three polymorphisms are designated by their positions with respect to the first base of the INS start codon that is represented by a solid triangle and marked as +1. The allelic variations at the VNTR begin at −603, positioned immediately before the basal promoter. The average length of a class I VNTR is ∼0.5 kb among the alleles we cloned and the class III used is ∼2.0 kb. A gray arrow depicts the basal insulin promoter region (365 bp) and open boxes denote the three insulin exons. The black bold lines represent the regions cloned into the luciferase reporter constructs including the VNTR, its 5′-flanking 1.1 kb region, the basal insulin promoter, and excluding the other two polymorphisms. The longer version bearing the 5′-flanking 1.1 kb in addition to the VNTR region and basal promoter construct, as well as a shorter construct without the 1.1 kb 5′-flanking region, were analyzed. B: A luciferase reporter gene is driven by class I or class III VNTR with insulin basal promoter (50 ng) and transfected in a hTEC line. Six class I and one class III haplotypes were tested. The relative activities both without (β-gal control) and with exogenous AIRE (50 ng) are shown. The class I activity was expressed as an average of six constructs. The class III activity was expressed as an average of three experiments from one construct. C: Detailed activities of each individual VNTR allele in the presence of AIRE were tabulated. D and E: The same set of constructs was assayed using rat primary thymic epithelial cells following the same strategy as in B and C. F and G: To rule out the possibility that the upstream 5′-flanking genomic region (∼1.1 kb) might contribute to the differential insulin expression in thymus, another set of constructs was made by removing this region (A) and assaying in the hTEC line. The average difference in thymic expression is consistently a threefold increase of class III over I VNTR haplotypes. H: Western blot analysis to verify AIRE expression in the transfected cell line. As a loading control, α-actin was used.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
getmorefigures.php?uid=PMC3012191&req=5

Figure 3: IDDM2-VNTR locus transduces a quantitative insulin expression signal in the presence of AIRE. A: Diagrammatic representation of the TH-INS-IGF2 interval on chromosome 11p15.5. INS or IDDM2 locus is bordered by TH (tyrosine hydroxylase) and IGF2 (insulin-like growth factor 2) loci. The three polymorphisms are designated by their positions with respect to the first base of the INS start codon that is represented by a solid triangle and marked as +1. The allelic variations at the VNTR begin at −603, positioned immediately before the basal promoter. The average length of a class I VNTR is ∼0.5 kb among the alleles we cloned and the class III used is ∼2.0 kb. A gray arrow depicts the basal insulin promoter region (365 bp) and open boxes denote the three insulin exons. The black bold lines represent the regions cloned into the luciferase reporter constructs including the VNTR, its 5′-flanking 1.1 kb region, the basal insulin promoter, and excluding the other two polymorphisms. The longer version bearing the 5′-flanking 1.1 kb in addition to the VNTR region and basal promoter construct, as well as a shorter construct without the 1.1 kb 5′-flanking region, were analyzed. B: A luciferase reporter gene is driven by class I or class III VNTR with insulin basal promoter (50 ng) and transfected in a hTEC line. Six class I and one class III haplotypes were tested. The relative activities both without (β-gal control) and with exogenous AIRE (50 ng) are shown. The class I activity was expressed as an average of six constructs. The class III activity was expressed as an average of three experiments from one construct. C: Detailed activities of each individual VNTR allele in the presence of AIRE were tabulated. D and E: The same set of constructs was assayed using rat primary thymic epithelial cells following the same strategy as in B and C. F and G: To rule out the possibility that the upstream 5′-flanking genomic region (∼1.1 kb) might contribute to the differential insulin expression in thymus, another set of constructs was made by removing this region (A) and assaying in the hTEC line. The average difference in thymic expression is consistently a threefold increase of class III over I VNTR haplotypes. H: Western blot analysis to verify AIRE expression in the transfected cell line. As a loading control, α-actin was used.

Mentions: A PCR amplicon from the human insulin basal promoter region was cloned into a promoterless luciferase vector, pGL3-Basic (Promega) as pINS-basal. Based on this construct, six individual class I VNTR alleles, including their 5′-flanking regions of about 1.1 kb, were first PCR amplified from individual human genomic DNA samples and subcloned into the pINS-basal construct to create the luciferase reporter construct series referred to as TD, HM, PQ, PW, KE, and RC (genomic DNA samples were obtained from Human Biological Data Interchange, Philadelphia, PA). The insert sequence of these constructs corresponds to the same genomic DNA on human chromosome 11p15.5, which includes the 5′-flanking region, VNTR, and the basal insulin promoter. The primer sequences used for cloning are listed as follow: INSpF, GACTCGAGACAGCAGCGCAAAGAGCCC; INSpR, CTTAAGCTTGCAGCCTGTCCTGGAGGGC; VNTR-5′, TACACGCTGCTGGGATCCTGGATCT; VNTR-3′, CTTGGAACAGACCTGCTTGA. The luciferase reporter vector for the class III VNTR was constructed from a λHI-3 clone (18). An artificial class III construct was assembled by linking four class I VNTRs 5′-upstream of the human insulin basal promoter sequentially. The 1.1 kb sequence 5′-upstream of the VNTR was deleted during the cloning process. Both ends of the artificial class III construct were confirmed by DNA sequence analysis. All of the PCR-generated amplicons were fully sequenced before use in any functional assay. For the heterologous promoter study, the insulin basal promoter was replaced by a SV40 promoter or SV40 promoter and enhancer for use in the reporter assays. A complete set of reporter construct without the 1.1 kb region were also constructed and described in Fig. 3A.


Both polymorphic variable number of tandem repeats and autoimmune regulator modulate differential expression of insulin in human thymic epithelial cells.

Cai CQ, Zhang T, Breslin MB, Giraud M, Lan MS - Diabetes (2010)

IDDM2-VNTR locus transduces a quantitative insulin expression signal in the presence of AIRE. A: Diagrammatic representation of the TH-INS-IGF2 interval on chromosome 11p15.5. INS or IDDM2 locus is bordered by TH (tyrosine hydroxylase) and IGF2 (insulin-like growth factor 2) loci. The three polymorphisms are designated by their positions with respect to the first base of the INS start codon that is represented by a solid triangle and marked as +1. The allelic variations at the VNTR begin at −603, positioned immediately before the basal promoter. The average length of a class I VNTR is ∼0.5 kb among the alleles we cloned and the class III used is ∼2.0 kb. A gray arrow depicts the basal insulin promoter region (365 bp) and open boxes denote the three insulin exons. The black bold lines represent the regions cloned into the luciferase reporter constructs including the VNTR, its 5′-flanking 1.1 kb region, the basal insulin promoter, and excluding the other two polymorphisms. The longer version bearing the 5′-flanking 1.1 kb in addition to the VNTR region and basal promoter construct, as well as a shorter construct without the 1.1 kb 5′-flanking region, were analyzed. B: A luciferase reporter gene is driven by class I or class III VNTR with insulin basal promoter (50 ng) and transfected in a hTEC line. Six class I and one class III haplotypes were tested. The relative activities both without (β-gal control) and with exogenous AIRE (50 ng) are shown. The class I activity was expressed as an average of six constructs. The class III activity was expressed as an average of three experiments from one construct. C: Detailed activities of each individual VNTR allele in the presence of AIRE were tabulated. D and E: The same set of constructs was assayed using rat primary thymic epithelial cells following the same strategy as in B and C. F and G: To rule out the possibility that the upstream 5′-flanking genomic region (∼1.1 kb) might contribute to the differential insulin expression in thymus, another set of constructs was made by removing this region (A) and assaying in the hTEC line. The average difference in thymic expression is consistently a threefold increase of class III over I VNTR haplotypes. H: Western blot analysis to verify AIRE expression in the transfected cell line. As a loading control, α-actin was used.
© Copyright Policy - creative-commons
Related In: Results  -  Collection

License
Show All Figures
getmorefigures.php?uid=PMC3012191&req=5

Figure 3: IDDM2-VNTR locus transduces a quantitative insulin expression signal in the presence of AIRE. A: Diagrammatic representation of the TH-INS-IGF2 interval on chromosome 11p15.5. INS or IDDM2 locus is bordered by TH (tyrosine hydroxylase) and IGF2 (insulin-like growth factor 2) loci. The three polymorphisms are designated by their positions with respect to the first base of the INS start codon that is represented by a solid triangle and marked as +1. The allelic variations at the VNTR begin at −603, positioned immediately before the basal promoter. The average length of a class I VNTR is ∼0.5 kb among the alleles we cloned and the class III used is ∼2.0 kb. A gray arrow depicts the basal insulin promoter region (365 bp) and open boxes denote the three insulin exons. The black bold lines represent the regions cloned into the luciferase reporter constructs including the VNTR, its 5′-flanking 1.1 kb region, the basal insulin promoter, and excluding the other two polymorphisms. The longer version bearing the 5′-flanking 1.1 kb in addition to the VNTR region and basal promoter construct, as well as a shorter construct without the 1.1 kb 5′-flanking region, were analyzed. B: A luciferase reporter gene is driven by class I or class III VNTR with insulin basal promoter (50 ng) and transfected in a hTEC line. Six class I and one class III haplotypes were tested. The relative activities both without (β-gal control) and with exogenous AIRE (50 ng) are shown. The class I activity was expressed as an average of six constructs. The class III activity was expressed as an average of three experiments from one construct. C: Detailed activities of each individual VNTR allele in the presence of AIRE were tabulated. D and E: The same set of constructs was assayed using rat primary thymic epithelial cells following the same strategy as in B and C. F and G: To rule out the possibility that the upstream 5′-flanking genomic region (∼1.1 kb) might contribute to the differential insulin expression in thymus, another set of constructs was made by removing this region (A) and assaying in the hTEC line. The average difference in thymic expression is consistently a threefold increase of class III over I VNTR haplotypes. H: Western blot analysis to verify AIRE expression in the transfected cell line. As a loading control, α-actin was used.
Mentions: A PCR amplicon from the human insulin basal promoter region was cloned into a promoterless luciferase vector, pGL3-Basic (Promega) as pINS-basal. Based on this construct, six individual class I VNTR alleles, including their 5′-flanking regions of about 1.1 kb, were first PCR amplified from individual human genomic DNA samples and subcloned into the pINS-basal construct to create the luciferase reporter construct series referred to as TD, HM, PQ, PW, KE, and RC (genomic DNA samples were obtained from Human Biological Data Interchange, Philadelphia, PA). The insert sequence of these constructs corresponds to the same genomic DNA on human chromosome 11p15.5, which includes the 5′-flanking region, VNTR, and the basal insulin promoter. The primer sequences used for cloning are listed as follow: INSpF, GACTCGAGACAGCAGCGCAAAGAGCCC; INSpR, CTTAAGCTTGCAGCCTGTCCTGGAGGGC; VNTR-5′, TACACGCTGCTGGGATCCTGGATCT; VNTR-3′, CTTGGAACAGACCTGCTTGA. The luciferase reporter vector for the class III VNTR was constructed from a λHI-3 clone (18). An artificial class III construct was assembled by linking four class I VNTRs 5′-upstream of the human insulin basal promoter sequentially. The 1.1 kb sequence 5′-upstream of the VNTR was deleted during the cloning process. Both ends of the artificial class III construct were confirmed by DNA sequence analysis. All of the PCR-generated amplicons were fully sequenced before use in any functional assay. For the heterologous promoter study, the insulin basal promoter was replaced by a SV40 promoter or SV40 promoter and enhancer for use in the reporter assays. A complete set of reporter construct without the 1.1 kb region were also constructed and described in Fig. 3A.

Bottom Line: In a protein-DNA pull-down experiment, AIRE protein is capable of binding to VNTR class I and III probes.Further, the transcriptional activation of the INS-VNTR by AIRE requires the insulin basal promoter.The VNTR sequence loses its activation activity when linked to a heterologous promoter and/or enhancer.

View Article: PubMed Central - PubMed

Affiliation: The Research Institute for Children, Children’s Hospital, New Orleans, Louisiana, USA.

ABSTRACT

Objective: Polymorphic INS-VNTR plays an important role in regulating insulin transcript expression in the human thymus that leads to either insulin autoimmunity or tolerance. The molecular mechanisms underlying the INS-VNTR haplotype-dependent insulin expression are still unclear. In this study, we determined the mechanistic components underlying the differential insulin gene expression in human thymic epithelial cells, which should have profound effects on the insulin autoimmune tolerance induction.

Research design and methods: A repetitive DNA region designated as a variable number of tandem repeats (VNTR) is located upstream of the human insulin gene and correlates with the incidence of type 1 diabetes. We generated six class I and two class III VNTR constructs linked to the human insulin basal promoter or SV40 heterologous promoter/enhancer and demonstrated that AIRE protein modulates the insulin promoter activities differentially through binding to the VNTR region.

Results: Here we show that in the presence of the autoimmune regulator (AIRE), the class III VNTR haplotype is responsible for an average of three-fold higher insulin expression than class I VNTR in thymic epithelial cells. In a protein-DNA pull-down experiment, AIRE protein is capable of binding to VNTR class I and III probes. Further, the transcriptional activation of the INS-VNTR by AIRE requires the insulin basal promoter. The VNTR sequence loses its activation activity when linked to a heterologous promoter and/or enhancer.

Conclusions: These findings demonstrate a type 1 diabetes predisposition encoded by the INS-VNTR locus and a critical function played by AIRE, which constitute a dual control mechanisms regulating quantitative expression of insulin in human thymic epithelial cells.

Show MeSH
Related in: MedlinePlus